ID: 1169150973

View in Genome Browser
Species Human (GRCh38)
Location 20:3289098-3289120
Sequence GCTACTTTGTAGAATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30328
Summary {0: 1, 1: 2, 2: 72, 3: 1961, 4: 28292}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169150973 Original CRISPR GCTACTTTGTAGAATGAGGT GGG Intronic
Too many off-targets to display for this crispr