ID: 1169151701

View in Genome Browser
Species Human (GRCh38)
Location 20:3294661-3294683
Sequence GTGTATATGCTGAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169151701_1169151703 -10 Left 1169151701 20:3294661-3294683 CCATCTTCCTTCAGCATATACAC 0: 1
1: 0
2: 1
3: 24
4: 226
Right 1169151703 20:3294674-3294696 GCATATACACTTTACACAACTGG 0: 1
1: 0
2: 0
3: 5
4: 100
1169151701_1169151704 -9 Left 1169151701 20:3294661-3294683 CCATCTTCCTTCAGCATATACAC 0: 1
1: 0
2: 1
3: 24
4: 226
Right 1169151704 20:3294675-3294697 CATATACACTTTACACAACTGGG 0: 1
1: 0
2: 1
3: 7
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169151701 Original CRISPR GTGTATATGCTGAAGGAAGA TGG (reversed) Intronic
902113108 1:14099427-14099449 GAGTATCTGGTGAAGGAACAGGG - Intergenic
904376218 1:30084096-30084118 GTGTTTATGTTGGAGAAAGAGGG - Intergenic
905459173 1:38111184-38111206 GAGTTGATGCTGGAGGAAGAAGG + Intergenic
906544509 1:46611880-46611902 GTCTGAATGCTGAAGGAAGCTGG - Intronic
907617495 1:55939168-55939190 GTGGATGTGGTGAAGGAAGATGG + Intergenic
911185723 1:94902707-94902729 GTGTGTATGAGGAAGGAAAATGG - Intronic
912575904 1:110673206-110673228 GAGTATATGGTGATCGAAGAGGG - Exonic
912700774 1:111876781-111876803 ATGTATAGGCTTAAGGGAGAAGG + Intronic
914697311 1:150096698-150096720 GTGGAAATTTTGAAGGAAGAAGG + Intronic
917268500 1:173247357-173247379 GAGTATGTTCTGAAGGAGGAGGG + Intergenic
919645066 1:200087207-200087229 GTGTATGTGTTGAAGGGAGAGGG - Intronic
921728851 1:218554211-218554233 GTGAGTATGATGAAGAAAGAAGG - Intergenic
923186086 1:231574872-231574894 ATGTGTATGATGAAGTAAGAGGG - Intronic
1064654508 10:17543828-17543850 TGGTATATGCTGAAGGGAGAGGG - Intergenic
1065094489 10:22267199-22267221 CTGTCTAGGCTGAAGGAATAAGG + Intergenic
1066710107 10:38224212-38224234 GTCCACATGCTGAAGCAAGAGGG - Intergenic
1066979904 10:42403242-42403264 GTTCACATGCTGAAGCAAGAGGG + Intergenic
1067211551 10:44263786-44263808 GTGTAGATACAGGAGGAAGATGG + Intergenic
1068036381 10:51765090-51765112 GTGTGTATTAGGAAGGAAGATGG + Intronic
1068975298 10:63002544-63002566 TTGGATAAGCTGAAAGAAGAGGG - Intergenic
1069224998 10:65932059-65932081 GTGTGTAAGCTGAAGGGAGGAGG + Intronic
1069780783 10:70954103-70954125 ATGGATGTGCTGAGGGAAGAAGG - Intergenic
1070953164 10:80446907-80446929 GTTTAAATGATGAAGGGAGAAGG - Intergenic
1071755021 10:88527665-88527687 GTGTATATGTGGGGGGAAGAGGG - Intronic
1072223971 10:93350871-93350893 GTGTATATGCTGAGAGATGGGGG - Intronic
1073630862 10:105147603-105147625 GTGCATGTCCTGAAAGAAGATGG - Exonic
1073673626 10:105619919-105619941 AAATATATGATGAAGGAAGAAGG + Intergenic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1076016363 10:127030459-127030481 ATGTCAATGCTGCAGGAAGAGGG - Intronic
1076160161 10:128237535-128237557 TTACAGATGCTGAAGGAAGATGG + Intergenic
1077819241 11:5719774-5719796 GGGCATTTGCTGAAGGAGGATGG - Intronic
1078339299 11:10487510-10487532 GCATATGTGCAGAAGGAAGATGG + Intronic
1079192149 11:18287971-18287993 GTGTATATGGAGATGGAAAAAGG - Exonic
1079714110 11:23722726-23722748 GTGTATATTTTCAAGGAAGCAGG + Intergenic
1079997744 11:27313500-27313522 GTGCATAGGCAGAAGGAAGGAGG + Intergenic
1081220825 11:40459138-40459160 GTGTATATGCATATGAAAGAGGG - Intronic
1081923925 11:46806877-46806899 GTGTAAAAGCTAAAGCAAGAAGG - Intronic
1084516713 11:69641667-69641689 GGGTATTTTCTGAAGGAGGAAGG + Intronic
1086531309 11:87788727-87788749 GAGTATAGGGTGAAAGAAGAGGG + Intergenic
1087194018 11:95286448-95286470 CTTTATATGCTAAGGGAAGAAGG + Intergenic
1088582790 11:111331601-111331623 GTTTACAAGCTGGAGGAAGAGGG + Intergenic
1090952330 11:131484624-131484646 GTGTCTACGCAGGAGGAAGAGGG - Intronic
1091384940 12:87684-87706 GTTTATATGCTGAAGAAAAAGGG + Intronic
1091482936 12:853733-853755 ATGTATGTGCTTATGGAAGAAGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1093005950 12:14050952-14050974 GTGTTTAGGATGAAAGAAGATGG - Intergenic
1093152011 12:15632995-15633017 TGGTAGATGCTGAGGGAAGAAGG + Intronic
1096020047 12:48316448-48316470 GTAGAGATGCTGCAGGAAGAAGG - Intergenic
1096099597 12:48961632-48961654 GTGTGTCTGATGAAGGAAGAGGG + Intergenic
1097039059 12:56143464-56143486 GAGTATGTGATGAAGGAACATGG + Intronic
1097093099 12:56523169-56523191 GTTTATATCCTGAAGAAATATGG + Intronic
1097373123 12:58808398-58808420 TAGTTTATGCTGAAGGAAAATGG - Intronic
1097943747 12:65343403-65343425 GTGTAAGTGCTACAGGAAGATGG - Intronic
1098088731 12:66878205-66878227 GTGTATGTCCTGCAGGAACATGG - Intergenic
1098371418 12:69764311-69764333 TTGTATATGGTGAAGGGGGATGG + Intronic
1098540993 12:71657636-71657658 GATTATTTTCTGAAGGAAGAGGG + Intronic
1099201796 12:79686912-79686934 GTGTATATTCTCAAGGAGCAAGG - Intronic
1099691514 12:85959316-85959338 TTGGATATGCTGAAAAAAGAGGG + Exonic
1099702717 12:86108213-86108235 GTCTAAATGCCAAAGGAAGAGGG - Intronic
1100018083 12:90036196-90036218 GTGGATATGATGAAAGAACAAGG + Intergenic
1101436736 12:104670424-104670446 GTGTATATGCTCCATGAAGGAGG - Intronic
1103871102 12:124092620-124092642 GTGGATATGGTGATGGATGATGG + Intronic
1104636418 12:130440375-130440397 GTGTCTGTGTTGGAGGAAGAAGG - Intronic
1106079494 13:26488376-26488398 GTGTGAATGCTGAAGCAAGAGGG - Intergenic
1106487755 13:30187594-30187616 GTGCACAGGCTGAAGCAAGATGG - Intergenic
1107342266 13:39420554-39420576 TTGTAGATACTGAAGGAAGTGGG + Intronic
1108605973 13:52038968-52038990 GTTTATATGCTGAGGAAAGGAGG + Intronic
1109894062 13:68659046-68659068 GTGTATTTGTTGGGGGAAGAAGG - Intergenic
1110801085 13:79695885-79695907 ATGTATATGTTTAGGGAAGAAGG + Intergenic
1110805848 13:79753295-79753317 GTGTATCTGATGAAGGACTATGG + Intergenic
1111186152 13:84738435-84738457 CTGGATATGATGGAGGAAGATGG + Intergenic
1112414132 13:99190267-99190289 AGGTGTATGCGGAAGGAAGAAGG + Intergenic
1113336082 13:109377215-109377237 GTGTGTCTGCTGAGGCAAGAGGG - Intergenic
1115466712 14:33723015-33723037 GTGTATATTCTGGAGATAGAAGG - Intronic
1120620574 14:86758735-86758757 GTGTTAATGATGAAGGTAGAGGG - Intergenic
1121947556 14:98137376-98137398 GTATATTTGCTGATGGAAGGGGG + Intergenic
1124786483 15:32686043-32686065 GTGTGTATGTTGAAGACAGAGGG - Intronic
1125416943 15:39463652-39463674 GTGTAGATACTGGAGGAAGATGG - Intergenic
1127869902 15:63063107-63063129 CTTTATATCCTGAAGGAGGAGGG + Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1128925741 15:71653854-71653876 GTGTATATGATACAGGATGAGGG + Intronic
1129175548 15:73837498-73837520 GAGTCTATGCTGAGGGAAGCTGG + Intergenic
1130402139 15:83567283-83567305 GGCAATATGCTGAAGAAAGATGG - Intronic
1131809650 15:96159402-96159424 GTGTATGTGCTTGAGAAAGAAGG - Intergenic
1133488940 16:6248489-6248511 GAGTATATTCTGAAAGGAGAGGG + Intronic
1134904396 16:17967645-17967667 GTGGATATGTTCATGGAAGACGG - Intergenic
1141071724 16:80962560-80962582 CTGTATATCTTAAAGGAAGATGG - Intergenic
1141864688 16:86741974-86741996 GTTTGTCTGCTGGAGGAAGAGGG - Intergenic
1149959203 17:61088928-61088950 GTGTACATGCCTGAGGAAGATGG + Intronic
1152156172 17:78634410-78634432 GTGTAAATGCTGAAGAAGAAGGG + Intergenic
1152476040 17:80518790-80518812 GGCTATATGCTGGAGGACGAAGG + Intergenic
1157400226 18:47381155-47381177 CTGGATATGCTGAATGAACATGG + Intergenic
1160340310 18:78083903-78083925 TTGCATTTGCTGCAGGAAGAAGG + Intergenic
1162449795 19:10747910-10747932 CTGTTAATGCTGCAGGAAGAAGG + Intronic
1162953180 19:14083869-14083891 TGGTCTCTGCTGAAGGAAGAAGG + Exonic
1164375288 19:27678737-27678759 GTGTCTATGTAGAAAGAAGAAGG - Intergenic
1164423524 19:28119142-28119164 GCTTATATGGTTAAGGAAGATGG - Intergenic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
926727588 2:16010487-16010509 GTGTACATCCTGAAGGAAGGAGG - Intergenic
929799090 2:45084033-45084055 GTGTCCATGCTGCAGGGAGAAGG - Intergenic
932132979 2:69204334-69204356 ATGGAGATGCTGAACGAAGATGG - Intronic
932561621 2:72876927-72876949 GAATATATACTGAATGAAGAAGG - Intergenic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
937041168 2:118821829-118821851 GTGTATATGATGAATAAAAATGG - Intergenic
937547510 2:123040980-123041002 GTTCAAATGCTGAAGGCAGAAGG + Intergenic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
938119683 2:128624774-128624796 GTCTCTCTGCTGAAGGAAGAAGG + Intergenic
940548509 2:155120467-155120489 GTATAAATGCTCAAGGGAGAAGG + Intergenic
941427195 2:165362849-165362871 GTGCATATGGTGAGTGAAGATGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943151834 2:184123426-184123448 GTATATTTTCTGAAGGTAGAAGG - Intergenic
943714302 2:191133504-191133526 GTATATATGCAGATGGAAGGTGG - Intronic
946469506 2:219945330-219945352 CTGGATATGCTGAAGAAAAATGG + Intergenic
946676658 2:222167675-222167697 GTGGACATGCTGAGGAAAGATGG - Intergenic
947105411 2:226663356-226663378 GTTTATAAGATGAAGAAAGAAGG - Intergenic
947306036 2:228748739-228748761 GTAAATAAGCTCAAGGAAGAAGG - Intergenic
948239562 2:236418519-236418541 GTGTTTATGCTGAAAGCATATGG + Intronic
948923144 2:241076124-241076146 GTGTATATGTGGAAGAAAAAAGG - Intronic
1168887761 20:1271721-1271743 GTGGATTTGCTGGAGGGAGAGGG + Intronic
1169151701 20:3294661-3294683 GTGTATATGCTGAAGGAAGATGG - Intronic
1170141854 20:13132666-13132688 GTTTATTTGCTGAGGTAAGAGGG - Intronic
1171136284 20:22697495-22697517 GTACATAAGCTGGAGGAAGAAGG - Intergenic
1172623971 20:36336958-36336980 ATGTATTTGCTGTAGGAGGAGGG - Intronic
1173257991 20:41408645-41408667 GTGGGTAGGCTGCAGGAAGAGGG - Intronic
1173441188 20:43077692-43077714 GGGTATATGCAGAGGGAAAAAGG + Intronic
1174139909 20:48405629-48405651 GTGTATGAGCTCAAGGAGGAAGG - Intergenic
1175028185 20:55925580-55925602 GTGTAAGTGCTGAAACAAGAAGG + Intergenic
1179895939 21:44363810-44363832 ATGTCTATGGTGAAGGAAGGAGG + Intronic
1182063980 22:27417393-27417415 AGGTATTTGCTGAAGGAAGGAGG + Intergenic
1182510399 22:30815614-30815636 GTGTATGTCCTGAGGGGAGATGG - Intronic
949412355 3:3779738-3779760 GTGTATTTCCACAAGGAAGAGGG + Intronic
950892770 3:16419396-16419418 GTGTGTATGATGTAGGAAGGGGG + Intronic
953946115 3:47149000-47149022 ATGTATATGCTGGAGGATTATGG - Intronic
954957409 3:54533838-54533860 GTGTAAATGTTGAAGCAAGTGGG + Intronic
955224067 3:57046822-57046844 GTGTATATTCTGAAGGATACAGG - Intronic
955448643 3:59042439-59042461 GGGTAAATGCTGTAGGTAGAGGG + Intronic
955527977 3:59840328-59840350 GGCAATATGCTGAAGGAAGTGGG - Intronic
956893104 3:73631940-73631962 GTGATTTAGCTGAAGGAAGAGGG - Intergenic
957393200 3:79605760-79605782 GTGGATATGTTGAAGACAGAAGG - Intronic
959481507 3:106878310-106878332 TTGTATATGGTGAAAGAAAAGGG + Intergenic
959608375 3:108266819-108266841 TTGTATGTGCTGACGGAAGGTGG - Intergenic
959617062 3:108360256-108360278 TTGTATATGCTGAGTTAAGATGG - Intronic
960357751 3:116674360-116674382 GTGTACATGCAGAAGGAGGTGGG - Intronic
961119423 3:124360837-124360859 TTGTCTACGCTGAAAGAAGAGGG + Intronic
964038409 3:152227434-152227456 CTATATATGCTGAAGAACGAGGG + Intergenic
964956981 3:162371747-162371769 TGGTATATGCTGAATGAATATGG + Intergenic
964967923 3:162521251-162521273 GTGTGTATTCTGCAGGAGGAAGG - Intergenic
965017874 3:163182830-163182852 ATGAAGATGATGAAGGAAGAAGG - Intergenic
965583309 3:170292492-170292514 TTATATCTGCTGAAGGCAGAGGG - Intronic
966033871 3:175385895-175385917 TTCTATATGCCCAAGGAAGAGGG + Intronic
967540802 3:190665499-190665521 GTGTATATGGTGAGGGGAGGAGG - Intergenic
971696602 4:29912350-29912372 TTGTATATGGTGAAAGGAGAGGG - Intergenic
973169985 4:47130207-47130229 GTCTTTATCCTGAAGGAAGTGGG - Intronic
973665923 4:53159355-53159377 ATGTATATTTTGAAGAAAGATGG - Intronic
973763759 4:54144990-54145012 TTGTATGTGCTAAAGGAAGATGG + Intronic
973848285 4:54935229-54935251 GTGTATATATTGGAGGTAGAAGG - Intergenic
973900002 4:55459629-55459651 GTGTAGATGCTAAAGGAATAAGG - Intronic
974914536 4:68163157-68163179 GTGTATATGGTGTAAGAAAAGGG - Intergenic
975053583 4:69898297-69898319 GTGTGCATGGTGGAGGAAGATGG - Intergenic
977353215 4:95914623-95914645 GTTCATATGTTGAAGGAAAATGG - Intergenic
977748000 4:100574737-100574759 GTGTACTTGCTAAAGGCAGATGG + Intronic
978076551 4:104538404-104538426 GTGTATATTCTCAATGAAGTAGG + Intergenic
978679974 4:111368445-111368467 TTATTTATCCTGAAGGAAGAAGG + Intergenic
979400789 4:120247038-120247060 GTGGATTTGCAGAAGGAAGAGGG + Intergenic
981504900 4:145488945-145488967 TTGCATAGGCAGAAGGAAGAGGG + Intronic
982699745 4:158647137-158647159 CTGTATCTTCTGAATGAAGAGGG - Exonic
982879943 4:160701275-160701297 GTTTTTATGCTGAAGAAGGAAGG + Intergenic
984296263 4:177858264-177858286 GTGTAAATGCTGTAGAAATAAGG - Intronic
984942738 4:184948713-184948735 GTGTATTTTCTAAAGGAAAAAGG - Intergenic
986229275 5:5846920-5846942 GTGTATATGGTGAAAGAAAGGGG + Intergenic
986257943 5:6116626-6116648 GTGAAGATACTGAAGGATGATGG + Intergenic
990839169 5:60056369-60056391 ATGTGAATGATGAAGGAAGACGG + Intronic
990972782 5:61527635-61527657 GTGTATGTGTTGAAGGAAGAAGG - Intronic
991202891 5:64014769-64014791 GTGTCTATGAAGAAGGAAGAGGG - Intergenic
991959005 5:72022879-72022901 GTGTGTGTGTTGGAGGAAGAGGG - Intergenic
994381735 5:99079560-99079582 CTGTCTATGCTGGAGGAAGTGGG + Intergenic
994697153 5:103086623-103086645 GTGTTTATCCTTATGGAAGAAGG - Exonic
995981001 5:118104183-118104205 CTTTATATGCTGAAGGAAAAAGG + Intergenic
996432679 5:123399224-123399246 GTGGCTGTGCTGAATGAAGAGGG - Exonic
996469594 5:123844557-123844579 GTGAGGATGCTGAAAGAAGATGG - Intergenic
996537007 5:124587985-124588007 GTGTGCATGCTGGGGGAAGATGG - Intergenic
996621063 5:125503736-125503758 GTGTATGTGATGGAGGTAGAGGG - Intergenic
998580014 5:143362965-143362987 GTGTATATGCTCAGGAAAGATGG + Intronic
999068677 5:148718850-148718872 GTTTCTATTCTGAAGGAGGAAGG - Intergenic
1000134413 5:158332516-158332538 TTGTATATGGTGAAAGAAGAGGG + Intergenic
1001497948 5:172203016-172203038 TTGTAGATGCTAAAGGAACAAGG - Intronic
1002859812 6:1070783-1070805 GTGGAAATGTTGCAGGAAGATGG - Intergenic
1002925070 6:1601356-1601378 GCCTTTGTGCTGAAGGAAGAAGG + Intergenic
1004698418 6:18055864-18055886 GTGAAGATGCTGAATGAATATGG - Intergenic
1005268185 6:24135254-24135276 TTGGATATGCTGATGGTAGAAGG + Intronic
1007009413 6:38400669-38400691 GTGTATTTGCTGAGACAAGAGGG - Intronic
1008042974 6:46821472-46821494 GTGTGTGTGTAGAAGGAAGAAGG + Intronic
1011425808 6:87228601-87228623 TTGTATATGGTGCAGGAATAGGG + Intronic
1012096640 6:94970862-94970884 GTGTATGTGGAGAAGGAAGAGGG + Intergenic
1012289691 6:97437480-97437502 GTGTGCATGATGAAGGAGGAAGG - Intergenic
1012950219 6:105510224-105510246 GGGTTTATGCAGAAAGAAGAGGG + Intergenic
1013942192 6:115678398-115678420 GTGTATATGTGGAAGGGAGTTGG + Intergenic
1015104156 6:129516910-129516932 CTTTTTATGCTGAAGGTAGAGGG + Intergenic
1015537241 6:134278949-134278971 GTGTAAATGGAGAAGGAAAAAGG + Intronic
1015738998 6:136433386-136433408 GTGTAGATGCTGACAGAAGAAGG - Intronic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1018719676 6:166563219-166563241 GTGTCTCTGGAGAAGGAAGATGG + Intronic
1018921254 6:168177450-168177472 GTGTGTATTCCGAAGGATGAAGG - Intergenic
1019029798 6:169000398-169000420 CTATAAATTCTGAAGGAAGAGGG - Intergenic
1020064960 7:5181126-5181148 GAGTATATGTTCAAGTAAGAGGG - Intergenic
1020411054 7:7892050-7892072 GAGTATATGATGGAGGAACAAGG + Intronic
1021876563 7:25054891-25054913 GAGTGTATGTTGAAGGAAGCAGG - Intergenic
1022274648 7:28843283-28843305 CTGTAGATGATGGAGGAAGATGG - Intergenic
1023639909 7:42247095-42247117 GTTTAGATGCAGGAGGAAGAAGG + Intergenic
1024628184 7:51226280-51226302 CTGTTTATGCTGCAGGCAGAAGG + Intronic
1024731681 7:52260312-52260334 GTGCATGTCCTGAAAGAAGAGGG + Intergenic
1024995941 7:55273302-55273324 CTCTATATGCTAAAAGAAGAGGG + Intergenic
1025010549 7:55394269-55394291 GTGTATACGATATAGGAAGAAGG + Intronic
1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG + Intergenic
1030899316 7:115103017-115103039 GTGCAAATGCTGAATGAAGAAGG + Intergenic
1030991688 7:116308762-116308784 GTATATATGCTGTATGATGAAGG + Intronic
1031199765 7:118666270-118666292 GTGTGTATGCACAAGGAAAAAGG + Intergenic
1032644346 7:133805816-133805838 TTTTATAAGTTGAAGGAAGAAGG + Intronic
1034696077 7:153055053-153055075 TTGGATATGGTGAAGGAGGAGGG + Intergenic
1037127215 8:15365877-15365899 ATGTAGATGCTGCAGGAAGTGGG - Intergenic
1038239105 8:25791623-25791645 GTATATATGCAGAAGGGAGATGG + Intergenic
1042018967 8:64349384-64349406 CTGTAAATCCTGAATGAAGAAGG + Intergenic
1042287658 8:67131936-67131958 GTGTATTTGATGTAGGAATACGG + Exonic
1043487870 8:80716192-80716214 GTGTCTATGATGAAGGATGAAGG - Intronic
1043922116 8:85995428-85995450 GTGAATGTGCTGAAGGAGCAGGG - Intronic
1045994705 8:108349517-108349539 ATGTATATGGTGCAGTAAGATGG + Intronic
1046497176 8:115030081-115030103 GTGTGAATGCTGAAGCAAGAGGG - Intergenic
1047471413 8:125177130-125177152 GTCTCTATGCTGAAGTTAGAAGG + Intronic
1048961242 8:139580236-139580258 GAGTATATGTTCAAGGAAAATGG - Intergenic
1049791142 8:144473252-144473274 GTGTCGGTGCTGAGGGAAGAAGG - Exonic
1051475795 9:17507823-17507845 CTGTGTCTGCTGAAGAAAGAAGG - Intergenic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055114521 9:72592515-72592537 GGGTAAATTCTGAAGGAGGAGGG - Intronic
1055509425 9:76980987-76981009 GTTTATATACTGTAGGAAAAGGG - Intergenic
1056047348 9:82732865-82732887 GTGGTTATGCTGGAGGAAGTGGG + Intergenic
1058238614 9:102526127-102526149 CTGTATATCCTGAAAGAATAAGG - Intergenic
1060368643 9:123046407-123046429 GTTTATATACTTAAGGAATAAGG + Intronic
1061035976 9:128114613-128114635 GTCTGAATGCTGGAGGAAGAAGG - Intergenic
1061602122 9:131677567-131677589 GTATATATCCTGAAGCAAAATGG - Intronic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1188728784 X:33619782-33619804 GTTTGTTTGCTGAAGGATGAGGG + Intergenic
1188888301 X:35577974-35577996 GTGTATATGGTGAAAGAGAAGGG - Intergenic
1192366703 X:70479811-70479833 GTGTATGTGCCCTAGGAAGAGGG + Intronic
1193509876 X:82385736-82385758 GAAAATATTCTGAAGGAAGAAGG + Intergenic
1195159140 X:102154592-102154614 CTGTATCTGATGAGGGAAGAAGG - Intronic
1196557243 X:117102199-117102221 TTGTATATGGTGAAAGATGAGGG + Intergenic
1197597476 X:128483272-128483294 GAGTATATGCTGTTGGAAAATGG + Intergenic
1197824677 X:130576071-130576093 GTGTAGATGCAGCGGGAAGAAGG - Intergenic
1197903561 X:131399183-131399205 ATGTAAATGCTGAAGGAAAAGGG + Intronic
1198148792 X:133887177-133887199 GTGTATATTTTGTAGGAACAGGG + Intronic
1198409355 X:136350073-136350095 GTCTTTCTGCTGAAGGATGAAGG - Exonic