ID: 1169157334

View in Genome Browser
Species Human (GRCh38)
Location 20:3342863-3342885
Sequence CCTCATTGAACCCATCTTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169157329_1169157334 23 Left 1169157329 20:3342817-3342839 CCTGCTGATCATGACAAAAGAGA 0: 1
1: 0
2: 0
3: 11
4: 148
Right 1169157334 20:3342863-3342885 CCTCATTGAACCCATCTTCGTGG 0: 1
1: 0
2: 1
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169157334 Original CRISPR CCTCATTGAACCCATCTTCG TGG Intronic
903878631 1:26493538-26493560 CCTCATTCTCCCCATCTTAGTGG - Intergenic
922344283 1:224683420-224683442 CCTCATTTAACTCTTCTGCGAGG + Intronic
1063237647 10:4135055-4135077 ACTCATTGATCCCATCTCCTTGG - Intergenic
1068627993 10:59270074-59270096 CCTCATTCTGCCCATCTTTGTGG + Exonic
1071923160 10:90374412-90374434 GCTCATTGAAGCCATCCTTGGGG + Intergenic
1077553567 11:3215106-3215128 CCTCATGGAGCTCATCTTCTAGG + Intergenic
1080248096 11:30202286-30202308 CCTCATAGAAAACATCTTCTGGG - Intergenic
1083670477 11:64297258-64297280 TCACATTGAAGCCATCTTCTTGG + Exonic
1086646833 11:89232616-89232638 TATGATTGAACCCATCATCGAGG - Intronic
1086965645 11:93025226-93025248 CTTCATTTAACCCAGCTGCGAGG + Intergenic
1096555940 12:52403810-52403832 CAACATCGAGCCCATCTTCGAGG - Exonic
1101471848 12:105004656-105004678 CCTCATTAAACCCATCTTGATGG - Intronic
1104335723 12:127892905-127892927 CCTCACTGAACCCCTCTACCTGG + Intergenic
1105664816 13:22542084-22542106 TCTGATTGAACCCATCTCCCAGG - Intergenic
1105686703 13:22790396-22790418 CCTTAATGAACCCATCTTCGGGG + Intergenic
1105990490 13:25615537-25615559 CCTGATTCAACCCTTCTTCCGGG + Intronic
1107760454 13:43672559-43672581 CCTCATTCAACCTAAGTTCGTGG - Intronic
1109575183 13:64246871-64246893 AATCAGTGAACCCATCTTTGTGG + Intergenic
1109912287 13:68930442-68930464 CCCCATTAAAGCCATCTTCCTGG - Intergenic
1112345092 13:98582759-98582781 TATCATTGAACTCATCTTCTTGG - Intergenic
1117375234 14:55113217-55113239 CTTCATTGAAGCCATCTGAGTGG + Intergenic
1119915121 14:78391952-78391974 CCTTATTGAATCAATCTTTGTGG - Intronic
1121415783 14:93778460-93778482 CCTCATTAAACACATCTCCATGG - Intronic
1121884972 14:97534654-97534676 CCTCATTCAGCCCCTCTTCAGGG - Intergenic
1130461038 15:84158323-84158345 CCACATGGAACCCATTTTCAAGG - Intergenic
1131095601 15:89652678-89652700 CCTCCTTGAGGCCTTCTTCGAGG - Exonic
1132406575 15:101544981-101545003 CCTCTTTGAACCTATCATTGTGG + Intergenic
1132997000 16:2828702-2828724 CTTCTTTGCACCCATCTTCCTGG + Intergenic
1133854733 16:9539077-9539099 CCTCATTTAACCCACCTTAGAGG + Intergenic
1137564649 16:49525402-49525424 CCTCATTGAGCACAGCTTCGAGG - Exonic
1138266838 16:55665662-55665684 CCTCACTGAACCCTTCCTCCAGG + Intronic
1139346446 16:66306846-66306868 CTGCATAGACCCCATCTTCGAGG - Intergenic
1142752288 17:1996209-1996231 TCTCATTGAACCCATCTCTGAGG + Intronic
1143922156 17:10338585-10338607 GCTCATTTAACCCACCTTAGAGG - Intronic
1149985170 17:61341749-61341771 ACTCCCTGAACCCATCTTTGGGG - Intronic
1150625838 17:66840556-66840578 CCTCAATGAACCCATCTGGCAGG + Intronic
1158801900 18:60921423-60921445 CCTCATTGTACCACTCTTCTTGG + Intergenic
1166726100 19:45028729-45028751 CCTCATGGAACCCATAGTCCAGG - Intronic
1167374827 19:49105010-49105032 CCTCATTGTACTCCTCTTAGTGG + Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
1168700100 19:58432892-58432914 CCTCAATGGACACATCTTAGGGG + Exonic
932137029 2:69240370-69240392 CCTCATTGAACAAATATTTGTGG + Intronic
932137272 2:69242295-69242317 CCTCTTTCATCCCATCTTCAGGG + Intronic
937869892 2:126779307-126779329 CTTCATTTAACCAATCATCGCGG + Intergenic
940540840 2:155014800-155014822 CTTCGTTGAAGCCATCTTAGTGG - Intergenic
940984760 2:160041718-160041740 TCTCATTGATCCCAGCTTCTTGG - Intronic
943475425 2:188348522-188348544 CCTCCTTATACCCATCTTCATGG - Intronic
944105478 2:196075321-196075343 CATCAATGAACACATCTTCCAGG + Intergenic
948100582 2:235369764-235369786 CCTCCTTCAAGCCATCTTCCTGG - Intergenic
1169123021 20:3108606-3108628 CCTCTCTGAAGCCATCTTTGTGG + Exonic
1169155166 20:3323580-3323602 CCTCAGTGAAGCAATCTTTGTGG + Intronic
1169157334 20:3342863-3342885 CCTCATTGAACCCATCTTCGTGG + Intronic
1170214540 20:13877278-13877300 GCTCATTGAACCCATTGTAGAGG - Intronic
1176284951 21:5014519-5014541 CCTCAGTGAACCCCGCTTCTGGG - Intergenic
1179872230 21:44248956-44248978 CCTCAGTGAACCCCGCTTCTGGG + Intronic
1180098404 21:45572475-45572497 CCTCACTGATCCCAGCTTCCAGG + Intergenic
1180840311 22:18956021-18956043 CCTCATTGTACCCTTCTCCATGG + Intergenic
1182488288 22:30652907-30652929 CCTCAGTAATCCCATCTTCCTGG - Intronic
953365016 3:42336866-42336888 CCTCATTGAAGTCAGCTTGGTGG + Intergenic
953890058 3:46744668-46744690 CCTCATTGACCCCAGCTGGGTGG - Exonic
961470684 3:127109522-127109544 CATCCTTGAACCCATCATCACGG - Intergenic
972774263 4:42226960-42226982 CCTTATAGAACCTACCTTCGAGG - Intergenic
985260020 4:188106501-188106523 CCTCTTTGACTCCATCTTCGCGG + Intronic
986366182 5:7034507-7034529 CATCATTGAACACTTCTTCCTGG - Intergenic
986768334 5:10948622-10948644 CCTCTCTGAACCCATCATGGTGG + Intergenic
987268868 5:16284423-16284445 CCTTTTTGAACCCTTCTTTGGGG + Intergenic
987708293 5:21482161-21482183 CCACATTGAACCCCACGTCGGGG - Intergenic
987708468 5:21482977-21482999 CCACATTGAACCCCACGTCGGGG - Intergenic
988751143 5:34191168-34191190 CCACATTGAACCCCACGTCGGGG + Intergenic
988751319 5:34191978-34192000 CCACATTGAACCCCACGTCGGGG + Intergenic
988751488 5:34192794-34192816 CCACATTGAACCCCACGTCGGGG + Intergenic
988778816 5:34500742-34500764 CTTCATTGAGCCCATCTTTTGGG - Intergenic
990314523 5:54571545-54571567 CCTCAATGAGCCCCTATTCGTGG - Intergenic
991736283 5:69633092-69633114 CCACATTGAACCCCACGTCGGGG + Intergenic
991736630 5:69634721-69634743 CCACATTGAACCCCACGTCGGGG + Intergenic
991736802 5:69635537-69635559 CCACATTGAACCCCACGTCGGGG + Intergenic
991758261 5:69899606-69899628 CCACATTGAACCCCACGTCGGGG - Intergenic
991758435 5:69900422-69900444 CCACATTGAACCCCACGTCGGGG - Intergenic
991758783 5:69902051-69902073 CCACATTGAACCCCACGTCGGGG - Intergenic
991812779 5:70488731-70488753 CCACATTGAACCCCACGTCGGGG + Intergenic
991812951 5:70489538-70489560 CCACATTGAACCCCACGTCGGGG + Intergenic
991813127 5:70490366-70490388 CCACATTGAACCCCACGTCGGGG + Intergenic
991815739 5:70509208-70509230 CCACATTGAACCCCACGTCGGGG + Intergenic
991816085 5:70510837-70510859 CCACATTGAACCCCACGTCGGGG + Intergenic
991837664 5:70775488-70775510 CCACATTGAACCCCACGTCGGGG - Intergenic
991838012 5:70777117-70777139 CCACATTGAACCCCACGTCGGGG - Intergenic
1005549291 6:26897806-26897828 CCACATTGAACCCCACGTCGGGG + Intergenic
1005549468 6:26898623-26898645 CCACATTGAACCCCACGTCGGGG + Intergenic
1005549644 6:26899443-26899465 CCACATTGAACCCCACGTCGGGG + Intergenic
1009020032 6:57938916-57938938 CCACATTGAACCCCACGTCGGGG + Intergenic
1016166034 6:140944930-140944952 CCTCATTGAATACATCTGCTAGG + Intergenic
1022197386 7:28082335-28082357 CCTCATTGAACTCTCCTTCCTGG + Intronic
1025723401 7:64036700-64036722 CCTCACTGACCCCTTTTTCGTGG - Intronic
1025752545 7:64306340-64306362 CCTCACTGACCCCTTTTTCGTGG - Intergenic
1029752514 7:102551321-102551343 TCTGATTTAACCCATCTTCAAGG - Intronic
1029770465 7:102650414-102650436 TCTGATTTAACCCATCTTCAAGG - Intronic
1030110242 7:106020771-106020793 CCTCATTGCACCCAGCTTGCTGG + Intronic
1034224227 7:149470355-149470377 CCACATTGAAGCCATGTTAGAGG - Intergenic
1035094347 7:156341302-156341324 CCTCATTGACCCCAGCTGCATGG + Intergenic
1037469016 8:19189066-19189088 TGTCATTGAACCCATCTTCTGGG - Intergenic
1056567093 9:87783249-87783271 CCTCATTGAACTAATGTTCTGGG + Intergenic
1060804454 9:126565683-126565705 CCTCATGGAACTCATGTTCCAGG + Intergenic
1193763879 X:85501673-85501695 CCTCTGTGAAGTCATCTTCGAGG - Intergenic
1199366371 X:146989256-146989278 CATCATTGAACAGATCTTCCGGG + Intergenic
1200247637 X:154534522-154534544 CCCCCTTGAACCCCTCTTCGGGG + Intronic
1202378218 Y:24256857-24256879 CCACATGGAACCCATTTTCAAGG + Intergenic
1202492564 Y:25413264-25413286 CCACATGGAACCCATTTTCAAGG - Intergenic