ID: 1169161228

View in Genome Browser
Species Human (GRCh38)
Location 20:3380155-3380177
Sequence GCTGAGGTGAAACGTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169161226_1169161228 -9 Left 1169161226 20:3380141-3380163 CCTTAGCAATCTGGGCTGAGGTG No data
Right 1169161228 20:3380155-3380177 GCTGAGGTGAAACGTGTGGCTGG No data
1169161222_1169161228 14 Left 1169161222 20:3380118-3380140 CCTTAATTTCAGTACTGTAATGT No data
Right 1169161228 20:3380155-3380177 GCTGAGGTGAAACGTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169161228 Original CRISPR GCTGAGGTGAAACGTGTGGC TGG Intronic