ID: 1169161228 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:3380155-3380177 |
Sequence | GCTGAGGTGAAACGTGTGGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1169161226_1169161228 | -9 | Left | 1169161226 | 20:3380141-3380163 | CCTTAGCAATCTGGGCTGAGGTG | No data | ||
Right | 1169161228 | 20:3380155-3380177 | GCTGAGGTGAAACGTGTGGCTGG | No data | ||||
1169161222_1169161228 | 14 | Left | 1169161222 | 20:3380118-3380140 | CCTTAATTTCAGTACTGTAATGT | No data | ||
Right | 1169161228 | 20:3380155-3380177 | GCTGAGGTGAAACGTGTGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1169161228 | Original CRISPR | GCTGAGGTGAAACGTGTGGC TGG | Intronic | ||