ID: 1169163699

View in Genome Browser
Species Human (GRCh38)
Location 20:3405252-3405274
Sequence TCATTTTCACAGATGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 431}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169163699_1169163704 21 Left 1169163699 20:3405252-3405274 CCATTCTCCATCTGTGAAAATGA 0: 1
1: 0
2: 2
3: 48
4: 431
Right 1169163704 20:3405296-3405318 ACTTGCAGAGTACTATCTATGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1169163699_1169163703 20 Left 1169163699 20:3405252-3405274 CCATTCTCCATCTGTGAAAATGA 0: 1
1: 0
2: 2
3: 48
4: 431
Right 1169163703 20:3405295-3405317 CACTTGCAGAGTACTATCTATGG 0: 1
1: 0
2: 1
3: 5
4: 85
1169163699_1169163705 28 Left 1169163699 20:3405252-3405274 CCATTCTCCATCTGTGAAAATGA 0: 1
1: 0
2: 2
3: 48
4: 431
Right 1169163705 20:3405303-3405325 GAGTACTATCTATGGGTCTTAGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169163699 Original CRISPR TCATTTTCACAGATGGAGAA TGG (reversed) Intronic
900389039 1:2426171-2426193 ACATCTGCACAGATGGTGAAAGG - Intronic
900785030 1:4644054-4644076 TGATTTTCACATCTAGAGAATGG - Intergenic
901355343 1:8642365-8642387 TCAGTTACACAGAGGGAGAAAGG - Intronic
902249578 1:15145348-15145370 TGATTGTCACAGCTGGGGAAAGG + Intergenic
903848485 1:26292177-26292199 TCCATTTCACAGATGGGTAAAGG - Intronic
904282005 1:29427200-29427222 TCATTCTGAAAGATGGAGGATGG + Intergenic
904455942 1:30648105-30648127 CCCATTTCCCAGATGGAGAACGG + Intergenic
906735676 1:48124591-48124613 TGATTTTCACATATGGTGAAAGG + Intergenic
906814008 1:48859119-48859141 TCATTGTGACAGAGGGAAAAGGG - Intronic
906884000 1:49624802-49624824 TTATTTTCTCACATGGAGAAAGG - Intronic
907252078 1:53146238-53146260 TCATTTTGACACATGGTGGAAGG - Intergenic
908312711 1:62901457-62901479 TCCTCTTTACAGATGGGGAATGG - Intergenic
908443001 1:64173630-64173652 GCTATTTTACAGATGGAGAAAGG - Intronic
909596266 1:77409907-77409929 TCATTTTCATATATGGTGTAAGG + Intronic
909606124 1:77510035-77510057 TCATCTAACCAGATGGAGAATGG + Intronic
912345186 1:108957175-108957197 TCATTTTGCCAGATGTAGTAGGG - Intronic
912393256 1:109319555-109319577 TTATTTTCAAAGTTGCAGAAGGG - Intronic
912479802 1:109973916-109973938 TCATTTTCAGATATGGAACAAGG + Intergenic
913327995 1:117644451-117644473 TCAGTTTCAGAGATGGAGCTAGG - Intergenic
914515751 1:148372699-148372721 CCATCTTCACAGATGGGGAAGGG - Intergenic
914859159 1:151372338-151372360 TGATTTTCCCAGCTGCAGAAAGG + Intronic
915658985 1:157385975-157385997 GTATATTCACAGATGCAGAAAGG + Intergenic
917599639 1:176561170-176561192 TCATTTCCTCAAATGGAAAAAGG + Intronic
917690409 1:177462585-177462607 TAGGTTTTACAGATGGAGAAAGG + Intergenic
918099007 1:181357375-181357397 CCATTTTCTCATATGGAGATGGG - Intergenic
918275480 1:182950084-182950106 TCAGTTTTACAGATAAAGAATGG - Intronic
918380486 1:183949487-183949509 TCTTTTTAACAAATGGTGAAGGG + Intronic
918449745 1:184646991-184647013 TCAGTCCCACACATGGAGAAAGG - Intergenic
919088084 1:192945406-192945428 GCGTTTTCACAGATGTAGTAGGG - Intergenic
920001052 1:202799038-202799060 TCATTTTCCCATATAGTGAAGGG - Intronic
920204110 1:204279100-204279122 TCATCTGCACAGAAGGAGGAGGG + Intronic
921186395 1:212673402-212673424 TCATGTTCACACATTGAGACGGG - Intergenic
921571958 1:216790340-216790362 TCCATTTTACAGATGGGGAATGG - Intronic
921985212 1:221305468-221305490 CCATTTTGACATTTGGAGAATGG - Intergenic
922579084 1:226683744-226683766 CCATTTTCTCAGATGAAGAAAGG - Intronic
923023316 1:230184166-230184188 TGATCTTCAAAGATGAAGAAGGG - Intronic
923335364 1:232965399-232965421 TCTGTTTCACAGATGAGGAAAGG - Intronic
923735103 1:236599226-236599248 TCATTTTTACAGATGAGGACAGG - Intronic
1063378512 10:5569424-5569446 ACTTTATGACAGATGGAGAAGGG - Intergenic
1063484732 10:6409081-6409103 TCATTTTCACAGTGAGAGAGAGG + Intergenic
1063581355 10:7310511-7310533 TCATTAGAACAGATAGAGAATGG - Intronic
1063695356 10:8329932-8329954 TCACTTACAAAGATGGTGAATGG + Intergenic
1063736635 10:8763213-8763235 TCTTTTTCCAAGATGGAGATTGG - Intergenic
1064527842 10:16276930-16276952 TCAGTTTCAGGGATGGAGAGAGG + Intergenic
1064571696 10:16700064-16700086 TCATTTTCACTTATGGAAATTGG + Intronic
1065384095 10:25116669-25116691 TGATTATCACAGCTGCAGAAGGG - Intergenic
1065416469 10:25492956-25492978 TCATTTTCAAATATTGAAAAGGG - Intronic
1065703878 10:28452548-28452570 TCAGTCTCATAGAAGGAGAAAGG - Intergenic
1066293095 10:34031487-34031509 ACATTTTCATAGATAGAGGATGG - Intergenic
1066491974 10:35902635-35902657 TCATTTTAACAGCTGGGAAAAGG - Intergenic
1067237584 10:44464266-44464288 TCAAATTCACAGATGCAGGAAGG - Intergenic
1067970032 10:50959146-50959168 TCATGTTCAAAGTTGGAGAGAGG - Intergenic
1068320972 10:55415495-55415517 TCATAATCAGAAATGGAGAAAGG - Intronic
1069675980 10:70248094-70248116 TCAGTTTCCCAGATGTAGGAAGG + Exonic
1069914157 10:71776903-71776925 ACATCTTCCCAGGTGGAGAAAGG + Intronic
1070688734 10:78509275-78509297 CCCATTTCACAGATGGACAAGGG + Intergenic
1072302587 10:94075835-94075857 TCAGTTTTTCAGATGGAAAATGG + Intronic
1073769681 10:106722537-106722559 TCATTTTCACAGTTGGTTAAAGG + Intronic
1073823719 10:107295189-107295211 TAATTTTCATATATGGTGAAAGG - Intergenic
1073850406 10:107610582-107610604 TCCATTTCATAGATGAAGAAAGG + Intergenic
1074367955 10:112875200-112875222 TCATTTTGACAAATGGATCATGG - Intergenic
1074663096 10:115686423-115686445 TCATTTTCCCATAAGGACAAAGG - Intronic
1075117324 10:119637882-119637904 TGATTTTTACAGATGCAAAAGGG - Intergenic
1075653360 10:124144893-124144915 TCTGTTTTACAGATGGAGAGAGG + Intergenic
1078551688 11:12285624-12285646 GCATTTTCACAAATGGAGTAAGG + Intronic
1078628818 11:12983289-12983311 TCTGTTTCCAAGATGGAGAAGGG - Intergenic
1079581901 11:22075626-22075648 TCATTTTCACTGATGGTCAGAGG - Intergenic
1080020228 11:27552398-27552420 TTATTGACAGAGATGGAGAAGGG + Intergenic
1080444253 11:32323172-32323194 TAATCTTCACAGATGGATTATGG + Intergenic
1080711768 11:34755216-34755238 TCATTTTCTCACTTGGAAAAAGG - Intergenic
1082641071 11:55662373-55662395 TTACTTTCACACATGGAGGATGG + Intergenic
1084040088 11:66537522-66537544 ACATTTTCAAAGATGGAAAGTGG - Intronic
1085584956 11:77693528-77693550 TGATCATCCCAGATGGAGAATGG - Exonic
1086081619 11:82908903-82908925 TCAGTTTTACAGAAAGAGAAGGG - Intronic
1086581607 11:88406195-88406217 TCAATGTTACAGATGAAGAAAGG - Intergenic
1087792190 11:102417969-102417991 TGATTTTCATATATGGTGAAAGG - Intronic
1087976333 11:104552293-104552315 TTTTTTTCACAGTTGGAGAAGGG - Intergenic
1089611579 11:119672358-119672380 TCATTACCCCAGAGGGAGAAGGG + Intronic
1089798953 11:121007798-121007820 TCATTTTAACAGAAGGAGAAAGG + Intergenic
1090413867 11:126527542-126527564 TCATTTTCCCATCTGGAAAATGG - Intronic
1090684506 11:129100558-129100580 TCTTGTTCACTGGTGGAGAAAGG - Intronic
1091284503 11:134400585-134400607 TCATTTTCACATATGGTGAGAGG - Intronic
1091721901 12:2820074-2820096 TCATGCCCACAGATGGAGATGGG + Exonic
1093816527 12:23555633-23555655 TTATTTTCACAGATGGCCAGTGG - Intronic
1094028427 12:25983904-25983926 TCATTTTCAAAGGTACAGAAAGG - Intronic
1094095839 12:26703571-26703593 TTATTTTCACAGTTGGGGAATGG - Intronic
1094268872 12:28589222-28589244 CCTTTCTAACAGATGGAGAAGGG + Intergenic
1094558314 12:31524911-31524933 TCATTTTAGTAGATGAAGAAAGG - Intronic
1095333718 12:41001790-41001812 TCATTTTCATATATGGTGTAAGG + Intronic
1095864655 12:46958122-46958144 CCAGCTTCACAGATGGATAATGG + Intergenic
1096536079 12:52275691-52275713 CCCATTTCACAGATGGAGAAAGG + Intronic
1097993684 12:65863935-65863957 TCATTTCTCCAGATGGAAAATGG + Intronic
1098335032 12:69395183-69395205 TTATTTTCACAGAAGGAAGAAGG + Intergenic
1100093981 12:91008538-91008560 ACAGTTTCTCAGATGCAGAATGG - Intergenic
1100355518 12:93825471-93825493 TCATTTTAAAACAAGGAGAAAGG - Intronic
1100372082 12:93977756-93977778 ACATTTAGACAGATGGAGATGGG + Intergenic
1100467778 12:94862705-94862727 TCATTTTCTCAGGTGGAGAGTGG - Intergenic
1101404152 12:104413239-104413261 TCAGTTTCTCAGATGTAAAATGG + Intergenic
1102419230 12:112791005-112791027 TCATTTTCACAGATGGGACTTGG + Intronic
1102479708 12:113213542-113213564 TCTATTTCACAGATGAAGAAAGG + Intronic
1102662559 12:114542466-114542488 CCATTTTCACAGGTGCAAAATGG + Intergenic
1102885880 12:116521459-116521481 CCATTGTCACACATGGAGACCGG - Intergenic
1103139160 12:118533780-118533802 TCATTTTCTCACCTGCAGAATGG + Intergenic
1104020304 12:124987913-124987935 TCGTTTTCACATCTGCAGAATGG - Intronic
1105730145 13:23205681-23205703 TCCATTTCACTGATGGAGAAGGG + Intronic
1105877855 13:24575110-24575132 TCATTTTCACCCAGTGAGAATGG - Intergenic
1107018126 13:35724983-35725005 TCATTATGCCAGAAGGAGAAGGG + Intergenic
1107293290 13:38881708-38881730 ACATTGTTACAGATGGTGAAGGG + Exonic
1107458374 13:40576634-40576656 TCATTTTCAGCGAGGGAGACAGG - Intronic
1107643278 13:42466847-42466869 TCATGTTCACTGATGCAGAGAGG + Intergenic
1107788789 13:43980116-43980138 TCATGGTGACAGAAGGAGAAAGG + Intergenic
1107901960 13:45025629-45025651 TCATTTTCCCAGCTGTAAAATGG - Intronic
1108200261 13:48036504-48036526 GCATATTAACAGAGGGAGAAAGG - Intergenic
1108426432 13:50306364-50306386 TTATCTCAACAGATGGAGAAAGG - Intronic
1109460433 13:62649590-62649612 TAAGTTTGAAAGATGGAGAATGG - Intergenic
1110971421 13:81767014-81767036 TAATTTCCACATATGGTGAAAGG - Intergenic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1111718693 13:91913696-91913718 TCAGAGTCACAGATGGAAAAGGG - Intronic
1111740727 13:92202754-92202776 TCATTCTTAAAGATGGGGAAAGG - Intronic
1112047926 13:95616348-95616370 TTGTTTTCATAGATGGAGAAAGG - Intronic
1112198568 13:97251792-97251814 TAAATATCACACATGGAGAAAGG - Intronic
1112203058 13:97296953-97296975 TCATTTTCTCAGATAGGAAAGGG + Intronic
1112809162 13:103197741-103197763 TCATTTCTACAAATGTAGAAAGG + Intergenic
1112927378 13:104693320-104693342 TGCTGTTGACAGATGGAGAATGG - Intergenic
1113052080 13:106223994-106224016 ACATTTTCACAAATAGAGAGTGG + Intergenic
1116360843 14:43996099-43996121 TCGGGTTCACAGAGGGAGAAAGG + Intergenic
1116462970 14:45198903-45198925 TCCTTTTCACAGATGAAAACTGG - Exonic
1117884306 14:60343609-60343631 GGATCTTCACAGATGGAGATGGG - Intergenic
1118790533 14:69087762-69087784 TTATTTTAAAAGATGGAGGAAGG + Intronic
1118901177 14:69987213-69987235 TCTTTTTCAAAGATGGACAATGG + Intronic
1119014400 14:71035264-71035286 TTACTTTCACATATGGGGAAAGG - Intronic
1119411143 14:74431308-74431330 CCCTTTACACAGAGGGAGAAAGG - Intergenic
1119494181 14:75064264-75064286 TCATTTTCTCATGAGGAGAAAGG + Intronic
1119654943 14:76410553-76410575 CCCATTTTACAGATGGAGAATGG + Intronic
1119701468 14:76758533-76758555 TCCATTTTACAGATGAAGAAAGG - Intergenic
1119921191 14:78447822-78447844 CCCATTTCACAGATGAAGAAAGG - Intronic
1120489268 14:85155963-85155985 TCATTTTGTCAGATTGAGGAAGG - Intergenic
1120934280 14:89878057-89878079 TCATTTTCTCAAATGGATAGGGG + Intronic
1121101991 14:91255629-91255651 TCCATTTCACAGATGGAAACAGG - Intergenic
1121523749 14:94604054-94604076 TCATTTTTAAAGAAGGAGCAGGG + Intronic
1122673588 14:103391138-103391160 TGGTTATCACAGCTGGAGAAAGG + Intronic
1202850021 14_GL000225v1_random:10302-10324 GGAATTTCACAGACGGAGAAGGG - Intergenic
1123739376 15:23220939-23220961 TCAGAGTCACAGATGGAAAAGGG - Intergenic
1124290595 15:28449891-28449913 TCAGAGTCACAGATGGAAAAGGG - Intergenic
1125033841 15:35100607-35100629 TCATTTTCAGAACTAGAGAAAGG - Intergenic
1125538104 15:40454360-40454382 TCATCTCCACAGAAGCAGAAAGG - Intronic
1125851834 15:42911466-42911488 CCAGTTTCAGAGAAGGAGAAAGG - Intronic
1126206410 15:46049946-46049968 TAATTTTCGCATATGGAGAAAGG + Intergenic
1126837568 15:52682313-52682335 TCACATTCACAGATGGGGGATGG - Intronic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1129690688 15:77711695-77711717 TCTATTTCACAAATGAAGAAAGG + Intronic
1131018107 15:89074546-89074568 TCATTTTCAGATAAGGAGAATGG - Intergenic
1131091422 15:89627412-89627434 TCATTTATGCAAATGGAGAAAGG + Exonic
1133437823 16:5795073-5795095 TCAGTTTCTCATGTGGAGAATGG + Intergenic
1134885779 16:17790216-17790238 TCAGTTTAACAGAGGGAGAAGGG + Intergenic
1135102350 16:19616992-19617014 TCATTTTGACAGCTGTGGAAGGG + Intronic
1135477372 16:22788714-22788736 TGATTTTCACAAATGGGGACTGG + Intergenic
1135555890 16:23436372-23436394 TCATTTTAGGAGATGGAAAAGGG + Intronic
1136708153 16:32207750-32207772 TCAGAGTCACAGATGGAAAAGGG + Intergenic
1136759755 16:32721660-32721682 TCAGAGTCACAGATGGAAAAGGG - Intergenic
1136808349 16:33148726-33148748 TCAGAGTCACAGATGGAAAAGGG + Intergenic
1137346939 16:47671185-47671207 TAATAATGACAGATGGAGAAAGG - Intronic
1137859881 16:51835858-51835880 TGATTTTCTCAGAAGGTGAAGGG - Intergenic
1138483148 16:57317392-57317414 GCATTTTGCCAGGTGGAGAAGGG + Intergenic
1138879374 16:60992036-60992058 TGATTATCACAAATGGGGAAGGG + Intergenic
1139182834 16:64768026-64768048 TCATTTTCAGAGAGGAAAAAGGG + Intergenic
1139321519 16:66118185-66118207 TCACTTTCCCATTTGGAGAATGG - Intergenic
1140305559 16:73799476-73799498 TCATCTGCAAAGATGGAGAAGGG + Intergenic
1140342127 16:74174719-74174741 GCATTTTGGGAGATGGAGAAGGG - Intergenic
1140783606 16:78318597-78318619 CCATTTTCTCAGTTGTAGAATGG + Intronic
1141014864 16:80439495-80439517 TCAATTTTACAGATTGGGAATGG - Intergenic
1141848206 16:86625770-86625792 TGTTTTACACAGATGAAGAAAGG + Intergenic
1203061909 16_KI270728v1_random:981967-981989 TCAGAGTCACAGATGGAAAAGGG - Intergenic
1143142847 17:4752185-4752207 TCATTTTCCCAGAAGCGGAATGG - Intergenic
1143440278 17:6966550-6966572 TCATTATCACAGAAGGGGACAGG + Intronic
1143851738 17:9817969-9817991 TGATTTTAATAGATGGAGATTGG - Intronic
1144237114 17:13272290-13272312 TCAGTTTCTCAGATGAAGACTGG - Intergenic
1144317335 17:14075027-14075049 GCATTTTCTCAGATGGAAAAGGG + Intronic
1144451053 17:15379054-15379076 TCATTTGTATAGATGGGGAAGGG + Intergenic
1145071594 17:19814194-19814216 TCATTTTTGTAGATGGAGCAAGG - Intronic
1145857557 17:28176503-28176525 TCCTTTTTACAGATGGGAAATGG + Intronic
1146085676 17:29826726-29826748 TCATTTTGAGAGATGGATATAGG - Intronic
1146834772 17:36101854-36101876 TGATTTTTACAGATGGTGTAAGG + Intergenic
1146849379 17:36209036-36209058 TGATTTTTACAGATGGTGTAAGG + Intronic
1146908267 17:36631811-36631833 TCTTTCTCAGAGATGGAGATGGG + Intergenic
1148867409 17:50635634-50635656 CCCTTCTCACAGATGGAGAAAGG + Intronic
1149301226 17:55305964-55305986 TTATTTCCACATATGGAAAATGG + Intronic
1151523687 17:74648939-74648961 TTATTTTGATAGATGGCGAATGG - Intergenic
1153754363 18:8264869-8264891 TCATTTTCTCATCTGGAAAATGG - Intronic
1155656905 18:28203336-28203358 TCATTTTCCAAGATGGATGATGG - Intergenic
1155991826 18:32286109-32286131 TCATTATCCCTGAGGGAGAAAGG - Intronic
1158325643 18:56311535-56311557 CCCATTTCACAGATGAAGAAAGG + Intergenic
1158790945 18:60779786-60779808 TTATTTTCATAGATGGTGAAAGG - Intergenic
1159893488 18:73974541-73974563 TCATTATCACAAATAGTGAAAGG + Intergenic
1162061788 19:8100673-8100695 TCATTTTAAAAAATGGATAATGG + Intronic
1162851634 19:13435558-13435580 TCATTTTCCCAGATGTACACTGG + Intronic
1164013986 19:21235678-21235700 CCATCTTCACAAAAGGAGAAAGG + Intronic
1166237949 19:41470056-41470078 TAATATTCACAGGGGGAGAAGGG - Intergenic
1166654637 19:44601635-44601657 TCAATTTCTCAGAAGGCGAAGGG + Intergenic
1166755726 19:45190019-45190041 TCTTTTTCTAAGATAGAGAAAGG + Intronic
925467950 2:4126786-4126808 TTATTTTTAAAGATGAAGAAAGG + Intergenic
925526493 2:4808727-4808749 TCATTTTCACATATGTACAATGG - Intergenic
926538648 2:14146572-14146594 TCATTTCCACAGATCCAGAATGG - Intergenic
926702793 2:15815023-15815045 ACATTTGCACAGAAGGAAAATGG - Intergenic
926916643 2:17898711-17898733 TTATTTTCAGAGAGGGAGCAAGG + Intronic
926986310 2:18628309-18628331 TCATTTTTATAGTTAGAGAAAGG - Intergenic
927040061 2:19220273-19220295 TCATTTTTCCAGATGGATAGTGG + Intergenic
927150764 2:20194462-20194484 TCCTCTTCCCTGATGGAGAAGGG - Intergenic
927666595 2:25037081-25037103 TCAATTTCCCAGATGTAAAATGG + Intergenic
930544602 2:52750621-52750643 TTACTTTCACAGATGCAGAGGGG + Intergenic
931499292 2:62846409-62846431 TCAATTCAACAGATGCAGAAAGG + Intronic
931718454 2:65048202-65048224 TCAATTGCTCAGATGGAGATGGG - Intergenic
932174889 2:69590745-69590767 CCATTTTCACAGTTGTAAAATGG + Intronic
932580604 2:72990634-72990656 CCCTTTTCACAGATAGAGACAGG + Intronic
933398905 2:81766190-81766212 CCATCTTCACAGCTGCAGAATGG - Intergenic
933473083 2:82752240-82752262 TCATGTTCAAAGATGCAGATTGG - Intergenic
934541296 2:95177511-95177533 TGGTTTTCACAGATGAAGAGTGG + Exonic
934684049 2:96307372-96307394 TCATGTTCACAGATGCAGCTGGG + Intergenic
935148387 2:100412178-100412200 TCATTTTCATTCATGGAGGAGGG + Intronic
935572028 2:104671679-104671701 ACATTTGCACAGTTGGTGAATGG - Intergenic
936394495 2:112111682-112111704 CCATTTCCACAGATGTATAAGGG - Intronic
936507157 2:113116896-113116918 TCATTTTGACAGCTGCAAAATGG - Intronic
936653517 2:114457344-114457366 TCATTGTCACAGCTGGGGAAGGG - Intronic
937747635 2:125433817-125433839 TCAGTTTCACATTTGCAGAATGG - Intergenic
940120657 2:150261138-150261160 TCCTTATCCCAGTTGGAGAAGGG + Intergenic
940234268 2:151492713-151492735 TCATTTTCAAAGAAGGGGCACGG + Intronic
940497863 2:154456928-154456950 TAATTTTCTAAGGTGGAGAAAGG + Intergenic
941374653 2:164712353-164712375 TGATTTTCACAGGTGGAAAAGGG + Intronic
942596739 2:177598809-177598831 CTCTTTTCACAGATGGAAAAAGG + Intergenic
942908909 2:181217844-181217866 TCATTTTCAAACTTGGAAAATGG - Intergenic
943171983 2:184413476-184413498 ATAATTTCACAGATGGAAAATGG + Intergenic
944168363 2:196747889-196747911 TCAGTTTCAGAGATGGAACATGG - Intronic
945125663 2:206506962-206506984 TCATTTTTAAAAATGGAAAAAGG + Intronic
945719145 2:213397014-213397036 TCATTAGCACAGAAGGTGAAGGG - Intronic
947021063 2:225676316-225676338 TAATTTTCACATATGGTGAGAGG + Intergenic
947265787 2:228278888-228278910 TCATTTTTGCATATGGTGAAAGG - Intergenic
1169040681 20:2492775-2492797 TGATCTTCACAGAAGCAGAATGG - Exonic
1169163699 20:3405252-3405274 TCATTTTCACAGATGGAGAATGG - Intronic
1169599201 20:7237645-7237667 TGATTTTCACAGAAGTAGTATGG + Intergenic
1169997747 20:11577447-11577469 TGATTTTAATAGATGGAAAAGGG - Intergenic
1170436898 20:16339647-16339669 TCATTTACTGAGATGGGGAAAGG - Intronic
1171089632 20:22271657-22271679 TCATTTTCACTGAGGGATGAGGG - Intergenic
1171987978 20:31673989-31674011 CCATTTTCACATATGTAAAATGG - Intronic
1172131766 20:32660693-32660715 TCCTTTTAACAGTGGGAGAATGG - Intergenic
1172202747 20:33138420-33138442 GGATTCTCACAGATGGAGTAGGG - Intergenic
1172207003 20:33170069-33170091 TAACTTTCAAAGATGCAGAAAGG + Intronic
1172882133 20:38208960-38208982 TCCATTTCACAGATGGGGAAAGG + Intergenic
1173391686 20:42640836-42640858 TCAAATTCCCAGATGGAGTAAGG - Intronic
1173893341 20:46530505-46530527 TCATTTTCTCACATGGAAAGAGG + Intergenic
1174378204 20:50140059-50140081 TCATTCACAGAGATGGAGAGAGG - Intronic
1174710936 20:52704260-52704282 TGATTTTCCCAAATGGACAAAGG - Intergenic
1174949190 20:55025871-55025893 TCATGTCTCCAGATGGAGAAAGG - Intergenic
1175474586 20:59262427-59262449 TCATTATCAGAGATGAACAATGG + Intergenic
1175590677 20:60189279-60189301 TTATTTTCAAGGTTGGAGAAAGG - Intergenic
1176127982 20:63484425-63484447 CCCCTTTCACCGATGGAGAAGGG + Intergenic
1176778889 21:13169477-13169499 TTTTTTTCTCAGATGGATAAAGG - Intergenic
1177867027 21:26524641-26524663 TCAATTACACAGAGAGAGAAGGG - Intronic
1180865771 22:19118847-19118869 TTCTCTACACAGATGGAGAAAGG + Intronic
1181479124 22:23186577-23186599 TCAGAGACACAGATGGAGAATGG - Intronic
1182692539 22:32174084-32174106 TCATTTTCCCATCTGTAGAAGGG + Intergenic
1182765314 22:32753914-32753936 TCAATTTCTCATATGGAAAATGG - Intronic
1183108558 22:35631483-35631505 GCTATTTGACAGATGGAGAAAGG - Intronic
1183896998 22:40977461-40977483 TCATTTTCACAGAGGAAGGCCGG + Intergenic
1184238254 22:43198089-43198111 TCATTTCCACATCTGAAGAATGG + Exonic
1184813570 22:46853702-46853724 TCAGTTTTATAGATGAAGAAGGG + Intronic
1184826481 22:46956022-46956044 TCATTTTCACATACTGAAAAAGG - Intronic
949434340 3:4012176-4012198 TAATTTTTACATATGGTGAAAGG - Intronic
949456057 3:4240002-4240024 TTATTTCAATAGATGGAGAAAGG - Intronic
950045034 3:9943969-9943991 TCATTTTTACATATGTAGAGTGG - Exonic
950203400 3:11060626-11060648 TCAGTTTCACAGATGAGGCATGG + Intergenic
950430851 3:12950144-12950166 CCATTTTCTCATATGGAGAATGG - Intronic
950812915 3:15666814-15666836 AGATTTGAACAGATGGAGAAGGG - Intergenic
950865753 3:16187904-16187926 TTGTTTTCACTGAGGGAGAATGG - Intronic
951159385 3:19398449-19398471 TCACTCTCACAGAAGGTGAATGG + Intronic
951674122 3:25217666-25217688 TCAGTTTCACAGATGAGGAAAGG - Intronic
951806586 3:26651136-26651158 TCATTTTGTCATATAGAGAATGG + Intronic
952466896 3:33598420-33598442 GCCATTTCACAGATGTAGAAGGG - Intronic
952531103 3:34262803-34262825 TCATTTTCTCAGAGAGAGAGAGG + Intergenic
952750397 3:36820398-36820420 TCTGTTTCACAGATGGACCAAGG - Intergenic
954340253 3:49947809-49947831 TCTTTTTCCCAAATGGAAAATGG - Intronic
954946783 3:54432863-54432885 TCATTTAAACACATGGAGATTGG - Intronic
956177909 3:66490822-66490844 TGATTTTCACAGATAGAAGATGG + Intronic
956253730 3:67261733-67261755 TCATATTGAAAGCTGGAGAAGGG - Intergenic
956263673 3:67373826-67373848 CCATTTTTACAGGTGGATAATGG - Intronic
957641156 3:82855203-82855225 TCATTTTCACATGTTGAAAAAGG + Intergenic
958626907 3:96637932-96637954 TGATTTTTACATATGGTGAAAGG - Intergenic
958634125 3:96721000-96721022 AAATCTTCAGAGATGGAGAAAGG + Intergenic
959263109 3:104104739-104104761 ACAATTTGACACATGGAGAATGG - Intergenic
959525678 3:107373621-107373643 TCATATTGAAAGAGGGAGAAAGG + Intergenic
960673321 3:120172313-120172335 GCATGTCTACAGATGGAGAAGGG - Intronic
960727879 3:120689331-120689353 TCATTTTCAAAGATGCAAAATGG - Exonic
960963774 3:123090608-123090630 TCATTTTCTCTGATGGAGGATGG + Intronic
961436488 3:126922285-126922307 TCATTTCCACATCTGCAGAATGG - Intronic
961937630 3:130602349-130602371 TCCTATTCAAAGATGGTGAATGG + Intronic
962250055 3:133830562-133830584 ACATTTTTACAGGTGGAGATGGG - Intronic
963026242 3:140922286-140922308 TCATCTTCACAGAAGCAAAAGGG - Intergenic
963492083 3:146015226-146015248 TCATTCTTGCACATGGAGAACGG + Intergenic
964012315 3:151905457-151905479 TCGTTGTCACAGCTGGAGTAGGG - Intergenic
966905688 3:184524224-184524246 AAATTTTCACAGCAGGAGAATGG + Intronic
967732843 3:192921864-192921886 GAATTTTGACAGATGGACAAAGG + Intergenic
967927728 3:194664570-194664592 TGATTTTGACAAATTGAGAATGG - Intronic
969516676 4:7652049-7652071 CCAGTTTCTCATATGGAGAATGG + Intronic
970325736 4:14921207-14921229 TCATTTGCACATATGGATGATGG - Intergenic
970506495 4:16735545-16735567 TCATTTCAATAAATGGAGAACGG + Intronic
970788106 4:19824409-19824431 TCATTTTCTCATATGTAAAATGG + Intergenic
971319717 4:25595566-25595588 TCCATTTCACTGATGCAGAAAGG - Intergenic
971595931 4:28528747-28528769 TCCATCTCACAGATAGAGAAAGG + Intergenic
971618204 4:28821403-28821425 TCTTTTTCACAAATGAGGAAAGG + Intergenic
972841823 4:42939872-42939894 TCAGGAACACAGATGGAGAATGG - Intronic
972900789 4:43680606-43680628 TCTTTTTCACAGTTGGAGCACGG + Intergenic
972941570 4:44201624-44201646 TAATTTTCATATATGGGGAAAGG - Intronic
973788267 4:54355169-54355191 TCATTTTCTCAGGTGTAAAATGG - Intergenic
974338897 4:60588217-60588239 TCACTTTCACAAATTAAGAAAGG + Intergenic
974362978 4:60907007-60907029 TCATTTGGAAAGATGGAGGAAGG + Intergenic
975472825 4:74790587-74790609 TCCTTTGGGCAGATGGAGAAGGG - Intronic
976097353 4:81523351-81523373 TTTTTTTAACAGATGGAGATAGG + Intronic
976484516 4:85586035-85586057 TCATTTTCTGAGAGAGAGAATGG - Intronic
976652310 4:87449130-87449152 TACTATTCACAGATGGAAAAGGG + Exonic
977573742 4:98656519-98656541 ACATTTTCACAAATGGAGAAGGG + Intronic
977947949 4:102935762-102935784 TTATTTTCAAAGATCTAGAATGG + Intronic
979045833 4:115862087-115862109 GAATTTTAAAAGATGGAGAAAGG + Intergenic
979350608 4:119640530-119640552 GTATTTGAACAGATGGAGAAAGG - Intergenic
979811184 4:125038219-125038241 TGATATTCACAGAAAGAGAAAGG + Intergenic
981143588 4:141299962-141299984 TAATTTTAAGAGGTGGAGAAAGG - Intergenic
981421478 4:144555386-144555408 TCTTGTGGACAGATGGAGAATGG + Intergenic
981897540 4:149820958-149820980 TGATTTCCACAAGTGGAGAAAGG + Intergenic
982175003 4:152697644-152697666 TCATTTTCTCACCTGGACAATGG - Intronic
984043812 4:174772155-174772177 TCATTTCCACAGAAGAATAATGG + Intronic
984488785 4:180405897-180405919 TCAATTACACAGAAGAAGAACGG + Intergenic
985605777 5:857453-857475 TCATATACACAGATGGAAACAGG - Intronic
985918479 5:2946864-2946886 TCATTTTCACAGATGTCCACTGG - Intergenic
986539263 5:8827005-8827027 TTATTTTCCAAGATGGAGTAGGG + Intergenic
986611448 5:9571989-9572011 CCATTTGTACAGATGAAGAATGG - Intergenic
987351743 5:17028133-17028155 TTATCTTCATAGATGCAGAAAGG + Intergenic
987693309 5:21296602-21296624 ACATTTTTACTGATGGCGAAAGG - Intergenic
987798664 5:22664720-22664742 TGATTTTCCCATATGTAGAATGG - Intronic
987837881 5:23185398-23185420 TCATTTTCTCATATGGTGTAGGG - Intergenic
988953310 5:36287331-36287353 TTATTTTCTCAGAGGCAGAAAGG - Intronic
989263242 5:39442739-39442761 TCATTTTCACACCTTCAGAAAGG - Intronic
989611315 5:43295268-43295290 TAATTTTATCAGATAGAGAAAGG + Intronic
989806590 5:45614927-45614949 GCATATTCACAGGTGGAGAGTGG + Intronic
990274265 5:54178644-54178666 TCATTATGAGAGTTGGAGAAGGG - Intronic
990379427 5:55207365-55207387 TCATTTTGTCAGGTGGGGAAGGG - Intergenic
990434511 5:55774684-55774706 TCATTTTTATAGATGGTGTAGGG + Intronic
991301446 5:65132923-65132945 TCATTTTCAGAGATGGGGCTGGG + Intergenic
991746968 5:69752954-69752976 ACATTTTTACTGATGGCGAAAGG + Intergenic
991750737 5:69802288-69802310 ACATTTTTACTGATGGCGAAAGG - Intergenic
991798570 5:70332896-70332918 ACATTTTTACTGATGGCGAAAGG + Intergenic
991826345 5:70628266-70628288 ACATTTTTACTGATGGCGAAAGG + Intergenic
991830026 5:70677185-70677207 ACATTTTTACTGATGGCGAAAGG - Intergenic
991890901 5:71332219-71332241 ACATTTTTACTGATGGCGAAAGG + Intergenic
993434351 5:87873095-87873117 TCATTCTCACAGCTGGAAACTGG + Intergenic
994475534 5:100263804-100263826 ACAGTTACAGAGATGGAGAATGG - Intergenic
995439015 5:112169276-112169298 TCATTTTCACATATTGTCAAGGG - Intronic
997368327 5:133339901-133339923 TCCTCTTCAGAGATGGGGAAGGG + Intronic
997802744 5:136882882-136882904 CCATTTTCACAGAAGGTGGATGG + Intergenic
998937790 5:147249262-147249284 CCATTTTCTCATATGTAGAAGGG + Intronic
999051528 5:148529030-148529052 TCCATTTCACAGATGAGGAAAGG + Intronic
999510555 5:152246491-152246513 TCTTTTTCAGAGATTAAGAATGG - Intergenic
1000286669 5:159832827-159832849 TCATTTTGATAAATGGAGAGTGG - Intergenic
1000769595 5:165336268-165336290 TAAATTCCACAGATTGAGAATGG + Intergenic
1001918212 5:175579539-175579561 TCATTTTCATACATGGTGAAAGG + Intergenic
1002347835 5:178560375-178560397 CCCATTTCAAAGATGGAGAAAGG - Intronic
1003204575 6:3995292-3995314 TCATGTTCACACAAGGAAAATGG - Intergenic
1003451276 6:6235112-6235134 TCATTTTTACATATGGTGCAAGG - Intronic
1003945443 6:11071317-11071339 GCATTTCCATAGATGGAGAAAGG - Intergenic
1004052893 6:12106239-12106261 TTATTTTCTCAAATGGAGATTGG + Intronic
1004789035 6:19003440-19003462 TCATTTTCTCAGATGGGACATGG - Intergenic
1005136795 6:22578157-22578179 CCATTTTAGCAGATGGAAAAAGG + Intergenic
1005279286 6:24254841-24254863 TCATTTTGACAGATACAGAAAGG + Intronic
1006196736 6:32247654-32247676 TCATTTGCACAGAGAGAGAAAGG - Intergenic
1008282942 6:49617796-49617818 TGATTATCACAGATGCTGAATGG - Intronic
1008301174 6:49841829-49841851 TCATTTTCTCAGCTGTAAAATGG + Intronic
1010760553 6:79717595-79717617 AGATTTTCACAGAAGGAAAACGG + Intergenic
1011034423 6:82957845-82957867 ACATTTTCATAGCTGTAGAATGG - Intronic
1011736827 6:90318961-90318983 TCATTTTCACAGGAGAAGAAAGG + Intergenic
1012175670 6:96079162-96079184 ACATTTTCAAAGGTGGGGAAGGG + Intronic
1012465640 6:99514279-99514301 GCATTTTCACTGATGGAGGAAGG - Intronic
1012523176 6:100145089-100145111 GGATTTTCACAGATGCAGAGTGG - Intergenic
1013569135 6:111402820-111402842 TCATTTTAAGAGAAGTAGAAGGG + Intronic
1013936167 6:115597152-115597174 TAATTTTAATAGATGGATAATGG + Intergenic
1013958604 6:115870228-115870250 TCATCTTTAGAGATGGAGTAGGG - Intergenic
1017260872 6:152385088-152385110 TCATTTTCCCCCATGGAAAATGG - Intronic
1017579770 6:155850824-155850846 CCATTTGCTCAGAAGGAGAAAGG + Intergenic
1018567329 6:165168545-165168567 TCATGTTCAGAGAGGGTGAAGGG - Intergenic
1018724045 6:166597030-166597052 TCATGGGAACAGATGGAGAAAGG + Intronic
1020490276 7:8774070-8774092 TAATTTTCATATATGGTGAAAGG + Intergenic
1020706552 7:11551168-11551190 TGATTTTCATATATGGTGAAAGG - Intronic
1021700000 7:23308860-23308882 TGATTGTCACAATTGGAGAAGGG - Intronic
1021709049 7:23396943-23396965 CCATTTTCACAGATGGGAAAGGG + Intronic
1022395230 7:29982356-29982378 TCATTTTCTCAGCTGTAAAATGG - Intronic
1023726901 7:43151794-43151816 TAATTGGAACAGATGGAGAAGGG + Intronic
1023737290 7:43246586-43246608 TCTTATTCACAGATGTGGAAAGG - Intronic
1026771055 7:73199308-73199330 TTTTTTTCCCAGATGGAGTATGG - Intergenic
1027011923 7:74752705-74752727 TTTTTTTCCCAGATGGAGTATGG - Intronic
1027076118 7:75193346-75193368 TTTTTTTCCCAGATGGAGTATGG + Intergenic
1027177470 7:75913996-75914018 TATTTTTAAAAGATGGAGAAGGG + Intronic
1027736154 7:81935551-81935573 TCATTTACAAAGTTGGGGAATGG + Intergenic
1027925607 7:84458967-84458989 TAATTTTCAGAGGTTGAGAAGGG - Intronic
1028003080 7:85526046-85526068 TCAATTTTACAGATTGAGAAAGG + Intergenic
1028203555 7:87990962-87990984 TTATTTTAAAAGAGGGAGAAAGG - Intronic
1028366499 7:90038532-90038554 TCATTTTCAAAGAGAGATAATGG - Intergenic
1028543222 7:91968474-91968496 TAATTTTCATAAAAGGAGAAAGG - Intronic
1030235033 7:107249253-107249275 TCATTGTCACAGTTGGGGATGGG + Intronic
1031268908 7:119619816-119619838 TAGTTTTCACAGAGGGAAAAGGG - Intergenic
1031478389 7:122249614-122249636 TCTTTTTTACATGTGGAGAAAGG + Intergenic
1031549256 7:123088223-123088245 TTATTATCACAGCTGGAGGAAGG - Intergenic
1033000244 7:137495715-137495737 TCATCTCAACAGATGTAGAAAGG + Intronic
1033026096 7:137774244-137774266 ACATTTTCACTGTTGGAAAAGGG + Intronic
1034407481 7:150914811-150914833 TAAATTTCTCAGAAGGAGAAGGG - Intergenic
1034905136 7:154937772-154937794 TCATTTTTGCACATGGTGAAAGG + Intronic
1035691824 8:1564323-1564345 CCAGTTTCACAGATGGTGGATGG + Intronic
1036491469 8:9230088-9230110 TGATTTTTACAAATGTAGAATGG - Intergenic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1038075599 8:24069849-24069871 TCATTTTCACATTTGGAAAGTGG + Intergenic
1038271098 8:26076623-26076645 TCATTTTCTCATCTGTAGAATGG - Intergenic
1038991547 8:32873748-32873770 GCATTTGCACAGATGCAGCAGGG + Intergenic
1039195181 8:35023286-35023308 TCTCTTCCAGAGATGGAGAAGGG + Intergenic
1039296246 8:36158639-36158661 TCATTTTCTCATATGCAAAATGG + Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1039883809 8:41644314-41644336 GCATCTTCACAGATGGAGGGTGG + Intergenic
1040428740 8:47317191-47317213 TCCCTTTCCTAGATGGAGAAAGG + Intronic
1040751261 8:50711884-50711906 GCATTTTCACTGTTAGAGAAGGG + Intronic
1041524753 8:58792757-58792779 TTATCTTCACAGAAAGAGAAGGG - Intergenic
1041564732 8:59263822-59263844 TCATATTCACTGATTGAAAAGGG + Intergenic
1042074404 8:64974497-64974519 TCATTTTAATAGATGCAGAAAGG - Intergenic
1042215576 8:66427723-66427745 TTATTTTCACAGATGAAACAAGG - Intergenic
1042859668 8:73299471-73299493 TCATTTTCATATTTGAAGAATGG + Intronic
1043206785 8:77454230-77454252 TCCTTTTCACAGATAGAGAGAGG + Intergenic
1043231178 8:77803317-77803339 GCTTATTCACAGATGGAGCACGG + Intergenic
1045558301 8:103236388-103236410 TTATTTTAACAGATGCAGAGAGG - Intergenic
1045673111 8:104578834-104578856 TTATCTTGACAGATGCAGAAAGG + Intronic
1046926146 8:119791160-119791182 GCATTTCCTCAGATGTAGAATGG - Intronic
1046963242 8:120132224-120132246 TAATTTTCATATATGGTGAAAGG + Intronic
1047063919 8:121259288-121259310 TTATTTTCACAGATGTAGCCTGG + Intergenic
1047129131 8:121999194-121999216 TGATTTTGAAAGATGGATAAGGG + Intergenic
1048618091 8:136101311-136101333 TGGTTTTCAAACATGGAGAATGG + Intergenic
1048745682 8:137612360-137612382 CCAGTGTCACAGATAGAGAAGGG + Intergenic
1050021183 9:1286040-1286062 TCCTGTTCACAGATGAAGGAAGG + Intergenic
1050561968 9:6843329-6843351 TCATTTTCAAAGATGGGGAGAGG - Intronic
1051302419 9:15665979-15666001 TCATTTAAACATATTGAGAAAGG + Intronic
1051675308 9:19552791-19552813 TGACTTTGGCAGATGGAGAAAGG - Intronic
1052519561 9:29528182-29528204 TCATTTATATAGATTGAGAAAGG - Intergenic
1055392605 9:75839319-75839341 TCATTTTCTCATTTGTAGAATGG + Intergenic
1055685405 9:78768145-78768167 TAATTTTCTCTGGTGGAGAAGGG + Intergenic
1056316171 9:85392539-85392561 TGATGTTCACAGATGCAAAAAGG + Intergenic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1059502823 9:114769934-114769956 ACTTTTGCACAAATGGAGAAGGG + Intergenic
1059810983 9:117855330-117855352 TAATTTTCTCAAATGTAGAATGG - Intergenic
1059983813 9:119801949-119801971 TTATTTTTACAGATAGAGCAAGG + Intergenic
1060446765 9:123696453-123696475 TCATTTTTAAAGGTGGAGAGTGG + Intronic
1060896062 9:127218371-127218393 TGATTTTCACTGAAGGAGATAGG + Intronic
1061408744 9:130406783-130406805 TCCATTTGACAGATGGAGAGCGG - Intronic
1061414134 9:130436900-130436922 TCCATTTTACAGATGCAGAAAGG + Intergenic
1061505296 9:131028412-131028434 TCATTATCCCAGATGGGCAAAGG - Intronic
1185787322 X:2901868-2901890 TCACATTCACAGATGGAGAGGGG - Intergenic
1186195585 X:7108006-7108028 TCTTTCTCACAGAAGGTGAATGG + Intronic
1186791832 X:13007290-13007312 TCATCTGCACAGAGGGAGAATGG - Intergenic
1188043100 X:25393443-25393465 GCTTTATCACAGCTGGAGAAAGG - Intergenic
1188688926 X:33104984-33105006 TCATTTTAACTGGGGGAGAATGG - Intronic
1189542198 X:42004073-42004095 TAATTTTTACATATGGTGAAAGG - Intergenic
1190431271 X:50379790-50379812 ACATTTACAGAGATGGGGAAAGG + Intronic
1194616426 X:96109571-96109593 ACAGTTTCACAGATGAAGAGAGG - Intergenic
1194939515 X:99993137-99993159 TCATTTTTAAAAATGGAGATGGG - Intergenic
1196093789 X:111776569-111776591 AGATATTCTCAGATGGAGAAAGG - Exonic
1196597594 X:117563318-117563340 TCATTGTCACAAAGGGAGCATGG - Intergenic
1197125968 X:122946565-122946587 CCACTTTGACAGATGAAGAATGG + Intergenic
1198141248 X:133805912-133805934 CCATTTTCACTGATGAAAAAAGG + Intronic
1198412654 X:136387354-136387376 TCCTTTTAACATATGGAGGAAGG + Intronic
1198728845 X:139705538-139705560 TAATTTTTGCATATGGAGAAAGG - Intronic
1198990218 X:142505177-142505199 TGAGTTTAACAGCTGGAGAAGGG - Intergenic
1199342942 X:146703548-146703570 TGATTTTCATATATGGTGAAAGG + Intergenic
1199747817 X:150785113-150785135 TGATCTTCAAACATGGAGAAAGG - Intronic
1200516363 Y:4148710-4148732 TCATTTGCACAGAGAGAGAGTGG + Intergenic
1200527579 Y:4294000-4294022 GGACTTTCATAGATGGAGAAAGG + Intergenic
1201177340 Y:11316837-11316859 AGAATTTCACAGATGGACAAGGG - Intergenic
1201628436 Y:16041361-16041383 TTATTTTAATAGATGCAGAAAGG - Intergenic
1201863058 Y:18620814-18620836 TCATTTTTACAGCTGGAGCAAGG + Intergenic
1201870265 Y:18699564-18699586 TCATTTTTACAGCTGGAGCAAGG - Intergenic
1202264071 Y:22999795-22999817 TCATTATCTCACATGGATAAAGG + Intronic
1202417062 Y:24633537-24633559 TCATTATCTCACATGGATAAAGG + Intronic
1202453725 Y:25036549-25036571 TCATTATCTCACATGGATAAAGG - Intronic