ID: 1169166755

View in Genome Browser
Species Human (GRCh38)
Location 20:3430693-3430715
Sequence GTAACCTCCCCGACATTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169166755_1169166761 25 Left 1169166755 20:3430693-3430715 CCAAGAAATGTCGGGGAGGTTAC No data
Right 1169166761 20:3430741-3430763 GCCAATGACTTACCAACAGAAGG No data
1169166755_1169166759 -4 Left 1169166755 20:3430693-3430715 CCAAGAAATGTCGGGGAGGTTAC No data
Right 1169166759 20:3430712-3430734 TTACACCTGTTCTAGGGGAGAGG No data
1169166755_1169166758 -9 Left 1169166755 20:3430693-3430715 CCAAGAAATGTCGGGGAGGTTAC No data
Right 1169166758 20:3430707-3430729 GGAGGTTACACCTGTTCTAGGGG No data
1169166755_1169166757 -10 Left 1169166755 20:3430693-3430715 CCAAGAAATGTCGGGGAGGTTAC No data
Right 1169166757 20:3430706-3430728 GGGAGGTTACACCTGTTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169166755 Original CRISPR GTAACCTCCCCGACATTTCT TGG (reversed) Intergenic
No off target data available for this crispr