ID: 1169167202

View in Genome Browser
Species Human (GRCh38)
Location 20:3434273-3434295
Sequence TTGTATGAAAAGAGTTAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169167202_1169167205 -8 Left 1169167202 20:3434273-3434295 CCATGCTAACTCTTTTCATACAA No data
Right 1169167205 20:3434288-3434310 TCATACAACAGAGGCCTGGCAGG No data
1169167202_1169167209 15 Left 1169167202 20:3434273-3434295 CCATGCTAACTCTTTTCATACAA No data
Right 1169167209 20:3434311-3434333 TGACATTTCCAGAGGGAGAATGG No data
1169167202_1169167208 8 Left 1169167202 20:3434273-3434295 CCATGCTAACTCTTTTCATACAA No data
Right 1169167208 20:3434304-3434326 TGGCAGGTGACATTTCCAGAGGG No data
1169167202_1169167207 7 Left 1169167202 20:3434273-3434295 CCATGCTAACTCTTTTCATACAA No data
Right 1169167207 20:3434303-3434325 CTGGCAGGTGACATTTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169167202 Original CRISPR TTGTATGAAAAGAGTTAGCA TGG (reversed) Intergenic
No off target data available for this crispr