ID: 1169168832

View in Genome Browser
Species Human (GRCh38)
Location 20:3447541-3447563
Sequence CAGAGCTTCAACTTTGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169168828_1169168832 0 Left 1169168828 20:3447518-3447540 CCCAGGGAGGAGGAACATGTTGC No data
Right 1169168832 20:3447541-3447563 CAGAGCTTCAACTTTGAAGGAGG No data
1169168829_1169168832 -1 Left 1169168829 20:3447519-3447541 CCAGGGAGGAGGAACATGTTGCC No data
Right 1169168832 20:3447541-3447563 CAGAGCTTCAACTTTGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169168832 Original CRISPR CAGAGCTTCAACTTTGAAGG AGG Intergenic
No off target data available for this crispr