ID: 1169171712

View in Genome Browser
Species Human (GRCh38)
Location 20:3470876-3470898
Sequence GAAGATCGCCTCCGGCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 21}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169171707_1169171712 23 Left 1169171707 20:3470830-3470852 CCGGGACAGCGCAGCCGGGTTTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1169171712 20:3470876-3470898 GAAGATCGCCTCCGGCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 21
1169171708_1169171712 9 Left 1169171708 20:3470844-3470866 CCGGGTTTCAGCTCGTTCTACGG 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1169171712 20:3470876-3470898 GAAGATCGCCTCCGGCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 21
1169171705_1169171712 27 Left 1169171705 20:3470826-3470848 CCGGCCGGGACAGCGCAGCCGGG 0: 1
1: 0
2: 1
3: 15
4: 163
Right 1169171712 20:3470876-3470898 GAAGATCGCCTCCGGCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169171712 Original CRISPR GAAGATCGCCTCCGGCGCCG CGG Intergenic
906678315 1:47708899-47708921 GGAGATCGCCTCCGACTCCCAGG - Intergenic
909490232 1:76218272-76218294 GAAGGTGGCCTCCGGGGCCAGGG - Intronic
917846578 1:179025693-179025715 GGAGACCGGCGCCGGCGCCGAGG + Intergenic
920021269 1:202958234-202958256 GCAGGCCGCCTCCAGCGCCGCGG - Exonic
1083317889 11:61827788-61827810 TAGGATCTCCTCCGGCGCCCGGG + Exonic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1113946977 13:114049926-114049948 GGAGATGGCCTCCGACCCCGCGG - Intronic
1119400066 14:74357232-74357254 GAAGATGGCCTCCAGCGTGGCGG - Exonic
1123030852 14:105450399-105450421 GAAAATCGTCTCCGCCGCCCAGG - Intronic
1125462412 15:39919960-39919982 GCACAACGCGTCCGGCGCCGAGG - Exonic
1142275779 16:89118113-89118135 GCAGATTCCCTCGGGCGCCGGGG + Intronic
1146469127 17:33110491-33110513 GAAGCTCACCTCAGGCGCCAGGG - Intronic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1154173459 18:12067282-12067304 GAAGAGCTCCCCCGGCGCCGTGG - Intergenic
1161159589 19:2754582-2754604 GAAGTGCGGCTCCGGCGTCGCGG + Intergenic
1163443755 19:17334643-17334665 CGAGGCCGCCTCCGGCGCCGGGG - Exonic
929776684 2:44934792-44934814 GAAGAGCGCCTCAGCAGCCGGGG - Intergenic
932616187 2:73233142-73233164 GGAGATGGTCCCCGGCGCCGCGG - Exonic
934771932 2:96912743-96912765 GAAGGTCGCATCCGGAGCCTGGG - Intronic
1169171712 20:3470876-3470898 GAAGATCGCCTCCGGCGCCGCGG + Intergenic
1173812347 20:45963768-45963790 GAAGGTCGACCTCGGCGCCGGGG + Exonic
952768496 3:36976292-36976314 GGAGATGGTCCCCGGCGCCGCGG + Intergenic
1034439816 7:151080907-151080929 GAAGTGCGCGCCCGGCGCCGAGG + Intergenic
1049008971 8:139874833-139874855 GAAGATCGCCCTGAGCGCCGTGG + Intronic