ID: 1169171860

View in Genome Browser
Species Human (GRCh38)
Location 20:3471484-3471506
Sequence GCGAGCAATGCCAGCACTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 592}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169171846_1169171860 18 Left 1169171846 20:3471443-3471465 CCCTGGCACCGGCCAGTGCGTCT 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1169171860 20:3471484-3471506 GCGAGCAATGCCAGCACTGCGGG 0: 1
1: 0
2: 3
3: 32
4: 592
1169171848_1169171860 10 Left 1169171848 20:3471451-3471473 CCGGCCAGTGCGTCTGCCCCGCC 0: 1
1: 0
2: 2
3: 14
4: 196
Right 1169171860 20:3471484-3471506 GCGAGCAATGCCAGCACTGCGGG 0: 1
1: 0
2: 3
3: 32
4: 592
1169171850_1169171860 6 Left 1169171850 20:3471455-3471477 CCAGTGCGTCTGCCCCGCCGGCT 0: 1
1: 0
2: 3
3: 17
4: 130
Right 1169171860 20:3471484-3471506 GCGAGCAATGCCAGCACTGCGGG 0: 1
1: 0
2: 3
3: 32
4: 592
1169171857_1169171860 -8 Left 1169171857 20:3471469-3471491 CCGCCGGCTGGGTGGGCGAGCAA 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1169171860 20:3471484-3471506 GCGAGCAATGCCAGCACTGCGGG 0: 1
1: 0
2: 3
3: 32
4: 592
1169171856_1169171860 -7 Left 1169171856 20:3471468-3471490 CCCGCCGGCTGGGTGGGCGAGCA 0: 1
1: 0
2: 2
3: 9
4: 117
Right 1169171860 20:3471484-3471506 GCGAGCAATGCCAGCACTGCGGG 0: 1
1: 0
2: 3
3: 32
4: 592
1169171855_1169171860 -6 Left 1169171855 20:3471467-3471489 CCCCGCCGGCTGGGTGGGCGAGC 0: 1
1: 0
2: 1
3: 10
4: 67
Right 1169171860 20:3471484-3471506 GCGAGCAATGCCAGCACTGCGGG 0: 1
1: 0
2: 3
3: 32
4: 592
1169171847_1169171860 17 Left 1169171847 20:3471444-3471466 CCTGGCACCGGCCAGTGCGTCTG 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1169171860 20:3471484-3471506 GCGAGCAATGCCAGCACTGCGGG 0: 1
1: 0
2: 3
3: 32
4: 592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169171860 Original CRISPR GCGAGCAATGCCAGCACTGC GGG Exonic
900268616 1:1774632-1774654 GCCTGCAATCCCAGCACTGTGGG - Intronic
900670552 1:3851161-3851183 GCCTGCAATCCCAGCTCTGCGGG + Intronic
901483791 1:9543844-9543866 GCCTGTAATGCCAGCACTGTGGG + Intronic
901645295 1:10713797-10713819 GCCAGCAATGCCAACCCGGCAGG - Intronic
902432457 1:16373860-16373882 GCCTGCAATCCCAGCACTCCGGG - Intronic
902434530 1:16389568-16389590 GCCTGCAATGCCAGCACTTTGGG - Intronic
902543444 1:17170662-17170684 ACAAGCAATGCCAGCACTTTAGG - Intergenic
902908194 1:19574951-19574973 GCCTGCAATCCCAGCACTTCGGG + Intergenic
903394442 1:22988895-22988917 GCCTGCAATCCCAGCACTGTGGG + Intergenic
903514548 1:23901864-23901886 GCAACCAATGCCAGTACTGCGGG - Intronic
903524641 1:23983866-23983888 GCTTGTAATGCCAGCACTTCGGG - Intergenic
903819152 1:26087912-26087934 GCCTGCAATCCCAGCACTGTAGG + Intergenic
903984576 1:27216765-27216787 GCCAGTAATCCCAGCACTTCAGG - Intergenic
904181851 1:28671453-28671475 GCCTGTAATGCCAGCACTGTGGG + Intronic
904189668 1:28733823-28733845 GCCTGTAATCCCAGCACTGCGGG - Intergenic
904568011 1:31439619-31439641 GCCAGTAATGCCAGCACTTTGGG + Intergenic
904740719 1:32673693-32673715 GCCTGCAATCCCAGCACTCCGGG - Intronic
906398004 1:45483736-45483758 GCCAGTAATTCCAGCACTTCCGG + Intronic
906519652 1:46459526-46459548 GCCAACACTCCCAGCACTGCAGG - Intergenic
907025144 1:51110707-51110729 GCCTGTAATCCCAGCACTGCGGG + Intronic
907032329 1:51184655-51184677 GCGTGCAATCCTAGCACTTCAGG + Intergenic
907138395 1:52160671-52160693 GCCTGTAATCCCAGCACTGCAGG - Intronic
907739618 1:57152071-57152093 GCCTGTAATGCCAGCACTTCGGG - Intronic
907777040 1:57526193-57526215 GCCTGTAATGCCAGCACTGTGGG - Intronic
908258454 1:62320847-62320869 GCCAGTAATCCCAGCACTGTGGG + Intergenic
910364063 1:86445155-86445177 GCCTGCAATCCCAGCACTTCAGG - Intronic
910571388 1:88708719-88708741 GCCTGCAATGCCAGCACTGTGGG - Intronic
911643330 1:100312349-100312371 GCTTGAAATCCCAGCACTGCGGG - Intergenic
911889104 1:103344556-103344578 GCCAGTAATGCCAGCACTTTGGG - Intergenic
913042908 1:115045782-115045804 GCTAGTAATCCCAGCACTTCGGG - Intergenic
913219527 1:116648283-116648305 GAGGACAATGCCAGCAATGCCGG + Intronic
913308426 1:117458781-117458803 GCCAGTAATCCCAGCACTTCAGG - Intronic
914687368 1:149992729-149992751 GCCAGCAATCCCAGCACTTTGGG - Intronic
914849620 1:151304602-151304624 GCCTGCAATCCCAGCACTTCGGG - Intronic
914930523 1:151927589-151927611 GCGAGTAATCCCAGCACTTTGGG - Intergenic
915074123 1:153295030-153295052 GCCTGCAATGCCAGCACTGTGGG - Intergenic
915230579 1:154442663-154442685 GCCAGCAAGGCCAGCACGGTCGG + Intronic
916163812 1:161946252-161946274 GCCTGCAATCCCAGCACTTCGGG - Intronic
916762573 1:167830651-167830673 GCTTGCAATCCCAGCACTTCGGG - Intronic
916948560 1:169756469-169756491 GCCTGCAATCCCAGCACTGTGGG + Intronic
919103901 1:193125519-193125541 GCCAGTAATCCCAGCACTTCGGG - Intronic
919629960 1:199950948-199950970 GCCAGTAATCCCAGCACTTCAGG + Intergenic
920273373 1:204784337-204784359 GCGAGTAATCCCAGCACTTTGGG - Intergenic
920659738 1:207905393-207905415 GCCTGCAATCCCAGCACTTCGGG - Intronic
921700438 1:218263241-218263263 GCCTGTAATGCCAGCACTGTGGG + Intergenic
922110260 1:222548849-222548871 GCATGTAATCCCAGCACTGCGGG + Intergenic
922937022 1:229430970-229430992 CCGAGTGTTGCCAGCACTGCCGG - Intergenic
923224067 1:231923016-231923038 GCCTGCAATCCCAGCACTGTGGG + Intronic
924349790 1:243103859-243103881 GTAAGCAATCCCAGCACTTCAGG + Intergenic
924521048 1:244806463-244806485 GCCTGTAATCCCAGCACTGCAGG + Intergenic
1062867583 10:869625-869647 GCCTGCAATGCCAGCACTTTGGG + Intronic
1063349366 10:5340042-5340064 GCCTGTAATGCCAGCACTGTGGG + Intergenic
1063351921 10:5364071-5364093 GCCAGTAATCCCAGCACTGTGGG - Intergenic
1063532722 10:6850698-6850720 GCCTGGAATGCCAGCACTGCGGG - Intergenic
1063642666 10:7846214-7846236 GCCTGTAATGCCAGCACTTCGGG - Intronic
1063650781 10:7935015-7935037 GCCTGTAATGCCAGCACTTCTGG + Intronic
1063699529 10:8371083-8371105 GCCTGCAATCCCAGCACTGTGGG - Intergenic
1064212947 10:13376019-13376041 GCCAGTAATGCCAGCACTTTGGG - Intergenic
1064309529 10:14200150-14200172 GCGTGTAATCCCAACACTGCGGG - Intronic
1064885268 10:20104791-20104813 GCCTGTAATCCCAGCACTGCGGG + Intronic
1065154681 10:22857001-22857023 GCCTGCAATGCCAGCACTTTGGG + Intergenic
1065519131 10:26554416-26554438 CCAAGGAATGCCAGCACTGCTGG - Intronic
1067550047 10:47227724-47227746 GCCAGAAGGGCCAGCACTGCAGG + Intergenic
1068554948 10:58448442-58448464 GAGAGCAGTGCCAGCACTGCTGG + Intergenic
1069030983 10:63595835-63595857 GCCTGCAATCCCAGCACTTCGGG - Intronic
1069144225 10:64868986-64869008 GCGTGCAATCCCAGCACTTTGGG - Intergenic
1069391306 10:67938684-67938706 GCCTGTAATGCCAGCACTTCGGG + Intronic
1069495283 10:68898114-68898136 GCGTGTAATCCCAGCACTTCGGG - Intergenic
1070100821 10:73384658-73384680 GTGTGTAATGCCAGCACTTCGGG - Intronic
1070999473 10:80816438-80816460 GCCTGTAATCCCAGCACTGCGGG + Intergenic
1072112961 10:92341141-92341163 GCTTGCAATCCCAGCACTTCAGG + Intronic
1072330157 10:94340720-94340742 GCCTGCAATCCCAGCACTTCAGG + Intronic
1072411614 10:95207848-95207870 GCTTGCAATGTCAGCACTTCGGG + Intronic
1072505627 10:96063453-96063475 ACCAGTAATGCCAGCACTTCTGG + Intergenic
1072961792 10:99935822-99935844 GCCTGCAATCCCAGCACTTCGGG - Intronic
1073036462 10:100567314-100567336 GAGGGCATTGCCAGCGCTGCCGG + Intergenic
1073753618 10:106557781-106557803 GCCAGCAATCCCAGCACTTTGGG - Intergenic
1074776694 10:116772383-116772405 GCCAGCAGAGCCAGCCCTGCTGG - Intergenic
1075521739 10:123147676-123147698 GCGGGCAAAGCCGGCACTCCTGG - Intergenic
1076327002 10:129631994-129632016 GCCTGCAATCCCAGCACTTCAGG - Intronic
1078258346 11:9680673-9680695 GCCTGCAATCCCAGCACTTCAGG - Intronic
1080085700 11:28279084-28279106 GCCTGCAATGCCAGCACTTTGGG - Intronic
1080607191 11:33873020-33873042 GCCTGCAATCCCAGCACTGTGGG - Intronic
1081788279 11:45764109-45764131 GCCTGCAATCCCAGCACTTCAGG + Intergenic
1082262116 11:50084461-50084483 GCCAGTAATCCCAGCACTTCAGG - Intergenic
1082863599 11:57878076-57878098 GCCAGCAATCCCAGCACTTTGGG - Intergenic
1083162065 11:60860567-60860589 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1083451867 11:62751664-62751686 GCCTGTAATCCCAGCACTGCGGG + Exonic
1083629310 11:64087600-64087622 GCGGGCAAGGCCAGCCTTGCAGG - Intronic
1083770995 11:64867457-64867479 GCCAGCAATCCCAGCACTTTGGG + Intronic
1083972415 11:66087500-66087522 GCCTGCAATCCCAGCACTGTGGG - Intronic
1084036145 11:66511737-66511759 GCCAGCAATCCCAGCACTTTGGG + Intronic
1084292323 11:68181914-68181936 CCTAGCAATGCCAGCACTTCAGG - Intronic
1084428514 11:69098557-69098579 GCCTGCAATCCCAGCACTGTGGG - Intergenic
1084585906 11:70062334-70062356 GCCTGTAATCCCAGCACTGCGGG - Intergenic
1084720475 11:70902457-70902479 GCGAGAAATCCCAGCTCTGAGGG - Intronic
1085982799 11:81744722-81744744 GCCAGGTCTGCCAGCACTGCCGG - Intergenic
1086088748 11:82983691-82983713 GCGTGTAATCCCAGCACTTCTGG - Intronic
1086255558 11:84871932-84871954 GCTTGAAATCCCAGCACTGCTGG - Intronic
1087843131 11:102940618-102940640 GCGTGTAATCCCAGCACTTCTGG - Intergenic
1088605609 11:111528056-111528078 GCCTGCAATCCCAGCACTTCAGG + Intronic
1089386530 11:118071905-118071927 CCCAGCAATGCCACCAGTGCTGG - Intergenic
1091401466 12:183295-183317 GCCAGGAATCCCAGCACTTCGGG + Intergenic
1091426836 12:397903-397925 GCCTGTAATCCCAGCACTGCAGG - Intronic
1091727591 12:2856620-2856642 GCCTGCAATCCCAGCACTTCGGG - Intronic
1091869765 12:3879218-3879240 GCCTGCAATGCCAGCACTTTGGG - Intergenic
1091880527 12:3973691-3973713 GTGACCAATGCCGGCACTGCAGG + Intergenic
1091995005 12:4986599-4986621 GCCTGTAATGCCAGCACTGTGGG - Intergenic
1093603376 12:21058602-21058624 GCCTGCAATCCCAGCACTTCAGG - Intronic
1093952982 12:25184871-25184893 GCCTGCAATTCCAGCACTTCGGG + Intronic
1095480179 12:42626440-42626462 GCCTGTAATCCCAGCACTGCGGG - Intergenic
1095719069 12:45380712-45380734 GCCTGCAATCCCAGCACTGTGGG + Intronic
1096002369 12:48140553-48140575 CCAAGGAATGCCAGCACAGCTGG - Intronic
1096472182 12:51886491-51886513 GCCTGCAATCCCAGCACTGTGGG + Intergenic
1096662276 12:53133436-53133458 GCGTGCAATTCCAGCACTTTGGG + Intergenic
1097291711 12:57922215-57922237 GCCAGTAATCCCAGCACTTCGGG + Intergenic
1097671124 12:62539755-62539777 GCCTGTAATCCCAGCACTGCAGG + Intronic
1098014676 12:66091799-66091821 GCCTGTAATGCCAGCACTTCGGG - Intergenic
1098797381 12:74907872-74907894 GCAAGTAATGCCAGTGCTGCTGG + Intergenic
1098983236 12:76982733-76982755 GCCAGGAATGCCAGCACTTTGGG - Intergenic
1099947965 12:89266512-89266534 GCTTGCAATCCCAGCACTTCGGG - Intergenic
1099968070 12:89472025-89472047 GCCTGTAATGCCAGCACTTCGGG - Intronic
1101408298 12:104448106-104448128 GCCTGCAATCCCAGCACTTCAGG - Intergenic
1101655184 12:106713806-106713828 GCCAGCAATCCCAGCACTTTGGG + Intronic
1102199375 12:111046914-111046936 GCCTGCAATCCCAGCACTGTGGG - Intronic
1102383661 12:112488436-112488458 CCGGCCAATTCCAGCACTGCGGG - Exonic
1102433476 12:112901717-112901739 GCCTGCAATCCCAGCACTGTGGG + Intergenic
1102870482 12:116410252-116410274 GCCAGTAATCCCAGCACTTCAGG + Intergenic
1103124381 12:118408591-118408613 GCCTGTAATCCCAGCACTGCGGG - Intronic
1103405344 12:120671144-120671166 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1103436122 12:120926569-120926591 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1103476955 12:121225668-121225690 GCGTGCAATCCCAGCACTTTGGG - Intronic
1103660556 12:122512063-122512085 GCCTGTAATGCCAGCACTTCGGG - Intronic
1104227083 12:126845647-126845669 GCCAGCAATCCCAGCACTTTGGG - Intergenic
1104820423 12:131674039-131674061 GCTAGTAATCCCAGCACTTCAGG - Intergenic
1104869990 12:131988129-131988151 GCCTGCAATCCCAGCACTCCAGG - Intronic
1104954378 12:132457286-132457308 GCGAGCAAGGCCGGTTCTGCTGG - Intergenic
1104979049 12:132564886-132564908 GCCTGAAATCCCAGCACTGCGGG - Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1107029144 13:35833191-35833213 CTAAGCAATGCCAGCAGTGCAGG + Intronic
1107909334 13:45090426-45090448 GCGTGCAATCCCAGCACTTTGGG - Intergenic
1110445676 13:75576988-75577010 GCCAGTAATGCCAGCACTTTGGG + Intronic
1111259017 13:85710597-85710619 GCCTGCAATGCCAGCACTTTGGG - Intergenic
1111580316 13:90214071-90214093 GGGTGCAATCCCAGCACTTCGGG - Intergenic
1112283611 13:98084387-98084409 GCCTGTAATGCCAGCACTTCGGG + Intergenic
1112879267 13:104085734-104085756 GCCTGCAATCCCAGCACTGTGGG - Intergenic
1113038887 13:106082929-106082951 GCCTGCAATCCCAGCACTTCAGG + Intergenic
1113665429 13:112137714-112137736 GCCAGTAATGCCAGCACTTTGGG + Intergenic
1114340930 14:21742979-21743001 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1114497039 14:23139949-23139971 GTGAGCTATGACTGCACTGCTGG + Intronic
1114515172 14:23294702-23294724 GCGTGTAATTCCAGCACTTCAGG + Intronic
1114544217 14:23486700-23486722 GAGGGCAATGGCAGCATTGCAGG - Intronic
1115609509 14:35037751-35037773 GCCTGTAATGCCAGCACTTCTGG - Intergenic
1116014924 14:39394984-39395006 GCGTGTAATGCCAGCACTTTGGG + Intergenic
1116974264 14:51097918-51097940 GCGTGTAATCCCAGCACTTCGGG - Intergenic
1117090663 14:52247013-52247035 GCCAGCAATCCCAGCACTTTTGG + Intergenic
1117111830 14:52465331-52465353 GCCTGCAATGCCAGCACTTTGGG + Intronic
1117688238 14:58277912-58277934 GCCTGCAATGCCAGCACTTTGGG + Intronic
1118017277 14:61672936-61672958 GCCTGCAATCCCAGCACTGTGGG - Intergenic
1118568541 14:67169815-67169837 GCCTGTAATGCCAGCACTTCGGG + Intronic
1118630808 14:67700763-67700785 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1119045350 14:71314150-71314172 GCCAGTAATTCCAGCACTTCAGG - Intergenic
1119343400 14:73900632-73900654 GCATGTAATCCCAGCACTGCGGG - Intronic
1119451782 14:74718122-74718144 GCCTGCAATCCCAGCACTTCGGG - Intronic
1119461289 14:74806095-74806117 GCCTGCAATGCCAGCACTTTGGG + Intronic
1119555417 14:75548701-75548723 GGGAGAAATGCCAGCACTCAGGG - Intergenic
1119701128 14:76755572-76755594 GGGAGCAAAGCCACGACTGCTGG - Intergenic
1119836952 14:77759247-77759269 GCCAGTAATGCCAGCACTGTGGG + Intronic
1122359187 14:101149027-101149049 GCCTGCAATCCCAGCACTTCAGG - Intergenic
1122894468 14:104749506-104749528 GAGAGGAATGCCAGCACAGCTGG + Intergenic
1123753096 15:23373600-23373622 GCCTGCAATGCCAGCACCCCGGG + Intergenic
1124018143 15:25895851-25895873 GCAAGCCATGCCAGCACCACTGG + Intergenic
1124176207 15:27426553-27426575 GCCAGTAATCCCAGCACTTCGGG + Intronic
1124356801 15:29001468-29001490 GCCTGTAATCCCAGCACTGCGGG - Intronic
1125808807 15:42518676-42518698 GCCTGCAATCCCAGCACTTCTGG - Intronic
1126229993 15:46313121-46313143 CCAAGCAATGCCAGGACTGCTGG - Intergenic
1127083571 15:55404810-55404832 GCCTGTAATGCCAGCACTTCGGG + Intronic
1127213112 15:56795810-56795832 GCCTGCAATCCCAGCACTGTGGG + Intronic
1127623555 15:60757945-60757967 GCTAGCAATGTCTGCATTGCTGG - Intronic
1127761868 15:62147310-62147332 GGGAGCAAGGGCAACACTGCTGG - Intergenic
1128090270 15:64914551-64914573 GCGTGCAATCCCAGCACTTTGGG - Intronic
1128587449 15:68861981-68862003 GCCTGTAATGCCAGCACTGTGGG - Intronic
1128623902 15:69179723-69179745 GCCTGCAATCCCAGCACTTCAGG + Intronic
1128919916 15:71601004-71601026 GCCTGTAATGCCAGCACTTCAGG - Intronic
1130665724 15:85868081-85868103 GCCAGTAATTCCAGCACTTCAGG - Intergenic
1131527037 15:93160589-93160611 GCCTGTAATCCCAGCACTGCGGG - Intergenic
1131732282 15:95294816-95294838 GCCTGCAATCCCAGCACTGTGGG - Intergenic
1132059157 15:98677194-98677216 GCCTGCAATGCCAGCACTTTGGG - Intronic
1132303545 15:100791269-100791291 GCCTGCAATCCCAGCACTGTGGG + Intergenic
1132672341 16:1106965-1106987 GACAGCAGTGCCAGGACTGCAGG + Intergenic
1134115917 16:11548714-11548736 GCCTGCAATCCCAGCACTTCGGG + Exonic
1134174217 16:11992900-11992922 GCCTGCAATCCCAGCACTTCAGG + Intronic
1134188381 16:12101641-12101663 GCCAGCAATCCCAGCACTTTGGG - Intronic
1134665830 16:16017931-16017953 GCAAGAAAAGCCAGCACAGCAGG + Intronic
1134669317 16:16043120-16043142 GCCTGTAATGCCAGCACTTCGGG - Intronic
1135225352 16:20651367-20651389 GCCTGCAATCCCAGCACTTCAGG + Intronic
1135343991 16:21672361-21672383 GCCAGCAATCCCAGCACTTTGGG + Intergenic
1136176053 16:28517568-28517590 GCCGGTAATGCCAGCACTGTGGG - Intergenic
1136822899 16:33336720-33336742 GCCAGCCAAGCCAGCACAGCCGG - Intergenic
1136823187 16:33337974-33337996 GCCAGCCAAGCCAGCACAGCCGG - Intergenic
1136823583 16:33339673-33339695 GCCAGCCAAGCCAGCACAGCCGG - Intergenic
1136834508 16:33491942-33491964 GCCAGCCAAGCCAGCACAGCCGG - Intergenic
1137662431 16:50220245-50220267 GCCTGTAATCCCAGCACTGCGGG - Intronic
1138131153 16:54481173-54481195 GCCTGTAATGCCAGCACTGTGGG - Intergenic
1138153121 16:54677834-54677856 GCCTGTAATGCCAGCACTTCCGG + Intergenic
1138468229 16:57209933-57209955 GCCTACAATGCCAGCACTTCGGG - Intronic
1138475778 16:57270026-57270048 GCCTGTAATGCCAGCACTGTGGG - Intronic
1139453510 16:67052137-67052159 GCCTGCAATCCCAGCACTGCGGG - Intronic
1139562606 16:67753244-67753266 GCCTGCAATCCCAGCACTTCGGG + Intronic
1139802172 16:69531747-69531769 GCGTGTAATCCCAGCACTGTGGG - Intergenic
1140060999 16:71569598-71569620 GCCTGCAATGCCAGCACTTTGGG - Intronic
1140198374 16:72874751-72874773 GCCGGCAATGCCAGCACTTTGGG - Intronic
1140739982 16:77932857-77932879 GCGAGCTATCTCAGCACTCCTGG - Intronic
1141101035 16:81197710-81197732 GCCTGTAATGCCAGCACTTCGGG + Intergenic
1141442340 16:84037499-84037521 GCCTGCAATCCCAGCACTTCTGG + Intronic
1142278563 16:89136032-89136054 GCCTGCAATCCCAGCACTGTGGG - Intronic
1142334989 16:89482664-89482686 GCCTGTAATTCCAGCACTGCTGG + Intronic
1142375484 16:89704840-89704862 GCCTGCAATCCCAGCACTGTGGG - Intergenic
1203010293 16_KI270728v1_random:232090-232112 GCCAGCCAAGCCAGCACAGCCGG + Intergenic
1142616290 17:1137823-1137845 GCGAGGTATGCCTGCACCGCAGG + Intronic
1142619610 17:1156422-1156444 GCCTGCAATGCCAGCACTTCGGG + Intronic
1142684307 17:1568904-1568926 GCGAGCATTTCCAGCACTTTGGG - Intergenic
1143035354 17:3992407-3992429 GCCTGCAATGCCAGCACTTTGGG + Intergenic
1143259844 17:5590073-5590095 GCCTGTAATGCCAGCACTTCGGG - Intronic
1143262652 17:5611584-5611606 GCCTGCAATCCCAGCACTGTGGG + Intronic
1144113759 17:12065557-12065579 GCCTGCAATCCCAGCACTGTGGG - Intronic
1144486741 17:15672472-15672494 GCCAGTAATGCCAGCACTTCAGG + Intronic
1144500395 17:15781508-15781530 GCCAGCAATCCCAGCACTTTGGG - Intergenic
1144669258 17:17123401-17123423 GCCTGTAATGCCAGCACTGTGGG + Intronic
1144914280 17:18709825-18709847 GCCAGTAATGCCAGCACTTCAGG - Intronic
1146303007 17:31705979-31706001 GCCTGCAATGCCAGCACTTTAGG + Intergenic
1146389426 17:32407886-32407908 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1146656041 17:34635914-34635936 GGGAGAAATCCCAGCACTGCTGG - Intronic
1146859435 17:36284188-36284210 GCCTGTAATCCCAGCACTGCGGG - Intronic
1147089759 17:38088275-38088297 GCCTGTAATCCCAGCACTGCGGG - Intergenic
1147107452 17:38232245-38232267 GCCTGTAATCCCAGCACTGCGGG + Intergenic
1147115157 17:38293660-38293682 GCGTGTAATCCCAGCACTTCGGG - Intergenic
1147225350 17:38972301-38972323 GCCTGTAATGCCAGCACTTCAGG - Intergenic
1148421946 17:47555604-47555626 GCCTGTAATCCCAGCACTGCGGG - Intronic
1148794443 17:50190333-50190355 GCCAGCAAAGCCAGCAGGGCCGG + Exonic
1148801440 17:50229123-50229145 GCCAGCAATCCCAGCACTGTGGG - Intergenic
1149406755 17:56359867-56359889 CAGAGCAATGGCAGCACTGTTGG - Intronic
1149675453 17:58456997-58457019 GCCTGCAATCCCAGCACTGTGGG + Intronic
1149738524 17:59019969-59019991 GCCAGTAATCCCAGCACTTCAGG + Intronic
1150421845 17:65043860-65043882 GCCTGAAATCCCAGCACTGCAGG + Intronic
1150682243 17:67293389-67293411 GCCTGCAATCCCAGCACTGTGGG - Intergenic
1150727660 17:67664642-67664664 GCCTGTAATGCCAGCACTTCGGG + Intronic
1153413703 18:4822747-4822769 GCGTGTAATCCCAGCACTGTGGG + Intergenic
1153572095 18:6483538-6483560 GCCTGTAATCCCAGCACTGCGGG - Intergenic
1153835437 18:8959687-8959709 CCGAGCAATGCCAGCACCGCAGG + Intergenic
1153907043 18:9670936-9670958 GCTTGCAATCCCAGCACTGTGGG - Intergenic
1154124046 18:11673854-11673876 GGGTGCAACACCAGCACTGCAGG - Intergenic
1154232385 18:12569079-12569101 GCCTGCAATCCCAGCACTTCGGG + Intronic
1156017716 18:32565300-32565322 GCCCGCAATCCCAGCACTGTGGG - Intergenic
1156085311 18:33392122-33392144 GCCTGCAATGCCAGCACTTTGGG - Intronic
1156178611 18:34576716-34576738 GCCTGCAATTCCAGCACTTCGGG - Intronic
1156700311 18:39817304-39817326 GCAGGTGATGCCAGCACTGCTGG + Intergenic
1157355454 18:46929500-46929522 GCCTGCAATCCCAGCACTTCGGG - Intronic
1157779428 18:50424411-50424433 GCCTGCAATGCCAGCACTTTGGG + Intergenic
1158665489 18:59429071-59429093 GCGAGGAATGCCAAGACTGTGGG + Intergenic
1158941120 18:62406505-62406527 GTGAGAAATCCCAGCACTGGAGG - Intergenic
1159109813 18:64043146-64043168 GAGCACAGTGCCAGCACTGCTGG - Intergenic
1159531594 18:69662237-69662259 GCCTGTAATCCCAGCACTGCGGG - Intronic
1160553683 18:79712539-79712561 GCCTGCAATTCCAGCACTTCGGG - Intronic
1160564857 18:79780648-79780670 GCCTGCAATCCCAGCACTGTGGG + Intergenic
1160574205 18:79841007-79841029 GCCAGTAATTCCAGCACTTCTGG + Intergenic
1160590211 18:79940341-79940363 GCCCGTAATGCCAGCACTTCGGG + Intronic
1161306026 19:3568722-3568744 GCCTGTAATGCCAGCACTGTGGG - Intronic
1161598976 19:5168955-5168977 GCCTGTAATGCCAGCACTGTGGG + Intronic
1161662713 19:5557084-5557106 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1161831497 19:6608303-6608325 GCCAGTAATCCCAGCACTTCGGG + Intergenic
1161877459 19:6922816-6922838 GCCTGTAATGCCAGCACTTCGGG + Intronic
1161921824 19:7272043-7272065 GCCTGTAATCCCAGCACTGCGGG + Intronic
1162052292 19:8041853-8041875 GCTAGTAATCCCAGCACTGTGGG + Intronic
1162231323 19:9269430-9269452 GCCTGTAATGCCAGCACTTCGGG - Intergenic
1162304639 19:9864558-9864580 GCCTGCAATCCCAGCACTTCGGG - Intronic
1162528414 19:11221081-11221103 GCCTGTAATCCCAGCACTGCAGG - Intronic
1162711988 19:12602285-12602307 GCCTGTAATCCCAGCACTGCGGG + Intronic
1162814446 19:13185188-13185210 GCCTGTAATCCCAGCACTGCGGG + Intergenic
1162896467 19:13767543-13767565 GCCTGTAATGCCAGCACTTCGGG + Intronic
1163515329 19:17759480-17759502 GCGTGTAATCCCAGCACTTCAGG - Intronic
1164252607 19:23494878-23494900 GCCAGTAATCCCAGCACTTCGGG + Intergenic
1164978689 19:32595892-32595914 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1165222337 19:34326893-34326915 GCCAGTAATCCCAGCACTTCGGG + Intronic
1165944695 19:39435037-39435059 GCCTGCAATCCCAGCACTTCGGG + Intronic
1166025880 19:40084166-40084188 GCGTGCAATCCCAGCACTTTGGG - Intronic
1166686268 19:44798296-44798318 GCCAGCAATCCCAGCACTTTGGG - Intronic
1166707808 19:44918009-44918031 GCCAGTAATCCCAGCACTGTGGG + Intronic
1166758406 19:45209306-45209328 GCGTGTAATCCCAGCACTGTGGG - Intronic
1166869669 19:45863832-45863854 GCCTGTAATTCCAGCACTGCAGG - Intergenic
1167439157 19:49498490-49498512 GCCAGTAATCCCAGCACTGTAGG + Intronic
1168026976 19:53649470-53649492 GCCTGCAATTCCAGCACTGGAGG + Intergenic
1168065688 19:53919027-53919049 GCCTGCAATTCCAGCACTTCGGG - Intronic
1168542037 19:57220901-57220923 GCCTGTAATGCCAGCACTTCGGG - Exonic
925930193 2:8701001-8701023 GCCTGCAATCCCAGCACTTCAGG + Intergenic
926688300 2:15715484-15715506 GCCTGCAATCCCAGCACTTCAGG - Intronic
927076723 2:19586117-19586139 GCCTGTAATACCAGCACTGCGGG + Intergenic
927577306 2:24210349-24210371 GCCTGCAATCCCAGCACTGTTGG + Intronic
928069145 2:28197110-28197132 GCCTGCAATCCCAGCACTTCAGG - Intronic
928523018 2:32109019-32109041 GCCTGTAATGCCAGCACTGTGGG - Intronic
928578913 2:32685287-32685309 GCCTGCAATCCCAGCACTTCGGG - Intronic
929041878 2:37752516-37752538 GCCTGCAATCCCAGCACTTCGGG + Intergenic
929424795 2:41833064-41833086 GCCAGTAATTCCAGCACTTCAGG + Intergenic
929725582 2:44423441-44423463 GCCTGTAATGCCAGCACTTCGGG - Intronic
931505483 2:62921915-62921937 GCCTGTAATGCCAGCACTTCGGG + Intronic
931724050 2:65091782-65091804 GCCAGTAATGCCAGCACTTTGGG - Intronic
931738806 2:65223221-65223243 GCCTGCAATGCCAGCACTTGGGG - Intergenic
932032791 2:68207894-68207916 GCCTGCAATGCCAGCACTTTAGG + Intronic
932695661 2:73954080-73954102 GCCTGCAATGCCAGCACTTTGGG + Intronic
934046145 2:88174033-88174055 CCAAGCAATGCCATCACTGCTGG - Intronic
934093705 2:88578286-88578308 GCCTGCAATCCCAGCACTTCGGG + Intronic
934476481 2:94596957-94596979 GCCAGCAATCCCAGCACTTTGGG - Intronic
935367242 2:102307650-102307672 GCCTGCAATGCCAGCACTTTGGG - Intergenic
936265014 2:110997793-110997815 GCCTGCAATTCCAGCACTTCGGG + Intronic
937113624 2:119387131-119387153 GCGAGGAATCCCAGCACTTTGGG - Intergenic
937857952 2:126686319-126686341 GAGAGCACTGCCCGCACTGCAGG + Intronic
938037332 2:128046096-128046118 GCGAGTAATCCCAGCACTTTGGG - Intergenic
938201657 2:129377333-129377355 GGGGGCAATGCCTGCACTGAGGG + Intergenic
938270884 2:129969973-129969995 GCGTGTAATGCCAGCACTTTGGG + Intergenic
938299333 2:130198949-130198971 GCCTGCAATCCCAGCACTTCGGG + Intergenic
938853818 2:135289511-135289533 GCCAGTAATCCCAGCACTGTGGG - Intronic
939970076 2:148647887-148647909 GCCTGCAATCCCAGCACTTCGGG - Intronic
941019128 2:160389436-160389458 GCCTGTAATGCCAGCACTTCGGG + Intronic
941292789 2:163697358-163697380 GCCTGCAATTCCAGCACTTCAGG - Intronic
941562003 2:167058338-167058360 GCCTGCAATCCCAGCACTGCAGG - Intronic
941730213 2:168908964-168908986 GCCTGCAATCCCAGCACTGTGGG - Intronic
942029846 2:171948481-171948503 GCCTGCAATCCCAGCACTTCAGG - Intronic
942179582 2:173367143-173367165 GCGGGCAATGCCAGTTCTGAAGG - Exonic
942180581 2:173376799-173376821 GCGTGTAATCCCAGCACTTCGGG - Intergenic
943669597 2:190647971-190647993 GCCTGTAATGCCAGCACTGTGGG - Intronic
944060241 2:195563991-195564013 GCCAGCAATCCCAGCACTTTGGG - Intergenic
944431207 2:199635582-199635604 GCCTGTAATGCCAGCACTTCGGG - Intergenic
944517804 2:200529785-200529807 GCCAGCAATCCCAGCACTTTGGG - Intronic
944735413 2:202558369-202558391 GCCTGTAATGCCAGCACTGTGGG - Intronic
944755739 2:202759958-202759980 GCCTGCAATCCCAGCACTTCAGG - Intronic
945129413 2:206552925-206552947 GCCAGCAATTCCAGCACTTTCGG - Intronic
946133520 2:217626662-217626684 GCCAGTAATCCCAGCACTTCAGG + Intronic
946268004 2:218565180-218565202 GCCAGTAATCCCAGCATTGCGGG - Intronic
947016998 2:225632078-225632100 CCGGGCAATCCCAGCACTTCAGG - Intronic
947932543 2:233975619-233975641 GCCTGCAATCCCAGCACTGTGGG + Intronic
948427680 2:237898056-237898078 GCCTGCAATCCCAGCACTGTGGG - Intronic
1168791866 20:583074-583096 GCCAGCAATCCCAGCACTTTGGG + Intergenic
1169014235 20:2278909-2278931 GCCAGCAATCCCAGCACTTTGGG - Intergenic
1169171860 20:3471484-3471506 GCGAGCAATGCCAGCACTGCGGG + Exonic
1171755265 20:29101285-29101307 GCCAGCAATCCCAGCACTTTGGG - Intergenic
1172522176 20:35574965-35574987 GCCTGTAATGCCAGCACTTCAGG - Intergenic
1172739642 20:37155868-37155890 GCTTGTAATCCCAGCACTGCCGG + Intronic
1172774843 20:37401260-37401282 GCCTGCAATCCCAGCACTGTGGG - Intronic
1173201154 20:40956005-40956027 GCCAGTAATCCCAGCACTTCGGG + Intergenic
1174777847 20:53362124-53362146 GCCTGTAATGCCAGCACTTCGGG - Intronic
1174782797 20:53405734-53405756 GCCAGTAATGCCAGCATTTCAGG + Intronic
1175252435 20:57617447-57617469 GTGAGCCATGCAAGCACAGCAGG - Intronic
1175975032 20:62706610-62706632 GCCAGCAATCCCAGCACTTTGGG + Intergenic
1176161263 20:63650129-63650151 GCCTGTAATCCCAGCACTGCGGG - Intronic
1176221865 20:63973487-63973509 GCCTGCAATCCCAGCACTGTGGG - Intronic
1176525326 21:7862089-7862111 GTGAGCAATGCCAGCAGGGATGG - Intergenic
1177384186 21:20387903-20387925 GCCAGCAATCCCAGCATTTCTGG - Intergenic
1177465923 21:21480105-21480127 GCCAGCAATCCCAGCACTTTGGG + Intronic
1177642992 21:23867999-23868021 GCCAGTAATCCCAGCACTGTGGG + Intergenic
1177914602 21:27073207-27073229 GCCTGTAATGCCAGCACTTCGGG - Intergenic
1178336579 21:31749134-31749156 GGCAGTAATGCCAGCACTTCAGG - Intergenic
1178409256 21:32350171-32350193 GCCTGCAATCCCAGCACTGTGGG + Intronic
1178525076 21:33321074-33321096 GCCTGCAATCCCAGCACTCCGGG + Intergenic
1178659346 21:34492102-34492124 GTGAGCAATGCCAGCAGGGATGG - Intergenic
1178751863 21:35312571-35312593 GCGTCCAATGCCACCTCTGCTGG - Intronic
1178972715 21:37195207-37195229 GGGAGGAGTGTCAGCACTGCAGG + Intronic
1179492572 21:41750935-41750957 GCCTGTAATCCCAGCACTGCGGG - Intronic
1179803510 21:43823304-43823326 GCCTGTAATGCCAGCACTTCGGG + Intergenic
1180738653 22:18037487-18037509 GCCTGTAATGCCAGCACTTCGGG - Intergenic
1180747268 22:18098399-18098421 GCCTGCAATCCCAGCACTTCGGG + Exonic
1180789652 22:18568317-18568339 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1181077038 22:20386681-20386703 GCCTGCAATCCCAGCACTGTGGG + Intronic
1181232090 22:21426995-21427017 GCCTGCAATCCCAGCACTTCGGG - Intronic
1181246561 22:21507865-21507887 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1181358903 22:22320040-22320062 GCCAGTAATCCCAGCACTTCAGG - Intergenic
1181777208 22:25168429-25168451 GCCTGGAATCCCAGCACTGCGGG + Intronic
1182413575 22:30206726-30206748 GCCTGTAATCCCAGCACTGCAGG - Intergenic
1182922487 22:34092901-34092923 GCCTGTAATCCCAGCACTGCAGG + Intergenic
1183782168 22:40005978-40006000 GCCTGTAATGCCAGCACTGTGGG + Intronic
1183807674 22:40225467-40225489 GCCAGTAATCCCAGCACTTCGGG + Intronic
1183917729 22:41136281-41136303 GCCTGCAATCCCAGCACTTCGGG - Intronic
1184486272 22:44781782-44781804 GCCTGCAATCCCAGCACTTCGGG - Intronic
1184707873 22:46227509-46227531 GCCCGCAATGCCAGCACTTTGGG - Intronic
1185312966 22:50166755-50166777 GCCTGCAATCCCAGCACTGTGGG + Intergenic
1185389961 22:50554432-50554454 GCGTGTAATCCCAGCACTTCAGG + Intronic
1203294091 22_KI270736v1_random:24033-24055 GCCTGCAATCCCAGCACTTCGGG + Intergenic
949341441 3:3035046-3035068 GCCTGCAATCCCAGCACTGTGGG + Intronic
950855477 3:16100736-16100758 GCCTGTAATCCCAGCACTGCAGG + Intergenic
950962902 3:17123925-17123947 GCCTGCAATGCCAGCACTTCGGG - Intergenic
950976860 3:17255777-17255799 GCCTGCAATCCCAGCACTTCGGG + Intronic
951023513 3:17806039-17806061 GCCTGTAATGCCAGCACTGTGGG + Intronic
951539011 3:23764873-23764895 GCCAGTAATCCCAGCACTTCGGG + Intergenic
951901633 3:27663420-27663442 GCAAGCAATCCCAGCACTTTGGG + Intergenic
952489374 3:33851717-33851739 GCCTGCAATCCCAGCACTTCAGG - Intronic
952948150 3:38495141-38495163 GCCTGCAATCCCAGCACTTCGGG - Intergenic
953739211 3:45522469-45522491 GCCTGTAATCCCAGCACTGCGGG + Intronic
954339732 3:49943566-49943588 GCCTGTAATGCCAGCACTTCGGG - Intronic
955289585 3:57678846-57678868 GCCAGTAATGCCAGCACTTTGGG + Intronic
955444422 3:58994275-58994297 GTGAGCAATGAGAGCACTGCAGG - Intronic
955935401 3:64098199-64098221 GTGAGAAATGCCATCCCTGCTGG - Exonic
956410154 3:68970790-68970812 TACAGCAATGCCAACACTGCAGG - Intergenic
956797832 3:72732257-72732279 TCAAACAATGCCGGCACTGCTGG - Intergenic
958795295 3:98700628-98700650 GCCTGTAATCCCAGCACTGCAGG - Intergenic
959159165 3:102703230-102703252 GCCAGCAATACCAGCACTTTGGG - Intergenic
959500923 3:107105298-107105320 CTGGCCAATGCCAGCACTGCAGG + Intergenic
961767522 3:129223063-129223085 GCCTGCAATCCCAGCACTTCGGG - Intergenic
962690149 3:137887609-137887631 GCCTGTAATGCCAGCACTGTGGG - Intergenic
963786338 3:149538177-149538199 GCGTGTAATCCCAGCACTTCGGG - Intronic
964344079 3:155738522-155738544 GCCTGTAATTCCAGCACTGCGGG + Intronic
964986702 3:162750641-162750663 GCTAGTAATGCCAGCACTTTGGG + Intergenic
965577802 3:170235822-170235844 GCCTGCAATGCCAGCACTTTGGG - Intronic
966117914 3:176487067-176487089 GCCTGCAATCCCAGCACTTCAGG + Intergenic
966440809 3:179942395-179942417 CAGAGCAATGACAACACTGCGGG + Intronic
968281321 3:197479016-197479038 GCCAGCAATGCCTGCACTCTGGG - Intergenic
968321383 3:197771832-197771854 GCCAGCAATCCCAGCACTTTGGG + Intronic
968474755 4:798654-798676 GCCTGCAATCCCAGCACTTCGGG - Intronic
968581175 4:1396084-1396106 GGGAGCAGCTCCAGCACTGCGGG + Intergenic
968644372 4:1731891-1731913 GCGTGCAATCCCAGCACTTTGGG - Intronic
970588560 4:17538391-17538413 GCGTGTAATCCCAGCACTTCGGG + Intergenic
971555294 4:28006212-28006234 GCCTGTAATGCCAGCACTTCGGG + Intergenic
972469898 4:39394402-39394424 GCGTGTAATCCCAGCACTTCGGG + Intergenic
972504580 4:39708157-39708179 GCCTGCAATCCCAGCACTTCGGG - Intronic
972603070 4:40589696-40589718 GCCTGCAATCCCAGCACTTCGGG - Intronic
973892410 4:55380467-55380489 GCCAGTAATGCCAGCACTTTGGG - Intergenic
973980464 4:56304516-56304538 GCCTGTAATGCCAGCACTTCGGG + Intronic
975338474 4:73208950-73208972 GCCTGCAATCCCAGCACTTCCGG + Intronic
975530159 4:75392142-75392164 GCGAATGAAGCCAGCACTGCTGG - Intergenic
977131193 4:93240250-93240272 TGGGGCAATGCCTGCACTGCTGG - Intronic
978083095 4:104618688-104618710 TCTAGCACAGCCAGCACTGCAGG - Intergenic
978323588 4:107525305-107525327 GCCTGTAATCCCAGCACTGCTGG - Intergenic
979679733 4:123446502-123446524 GCCTGCAATGCCAGCACTTTGGG + Intergenic
979705152 4:123711993-123712015 GCTTGCAATCCCAGCACTTCGGG - Intergenic
980911019 4:138994623-138994645 GCCATCAATCCCAGCACTTCGGG - Intergenic
981165880 4:141556304-141556326 GCCTGTAATGCCAGCACTTCGGG - Intergenic
981425823 4:144601900-144601922 GCTTGTAATGCCAGCACTTCGGG + Intergenic
981498968 4:145426231-145426253 GCGTGCTATGCCTGCACTACTGG + Intergenic
982156651 4:152529705-152529727 GCCTGCAATCCCAGCACTGAGGG + Intronic
982263303 4:153515069-153515091 GCCTGCAATCCCAGCACTTCGGG - Intronic
983039060 4:162902791-162902813 GCCTGTAATGCCAGCACTGTGGG + Intergenic
983467247 4:168109949-168109971 GCCAGTAATCCCAGCACTTCGGG + Intronic
983565116 4:169142213-169142235 GCCTGTAATGCCAGCACTGTGGG - Intronic
984456387 4:179974635-179974657 GCCTGCAATGCCAGCACTTTGGG - Intergenic
984490648 4:180430869-180430891 GCCTGCAATGCCAGCACTTTGGG - Intergenic
984557888 4:181237027-181237049 GCCTGCAATCCCAGCACTTCAGG - Intergenic
984666019 4:182430751-182430773 GCCTGTAATCCCAGCACTGCAGG + Intronic
985047288 4:185953053-185953075 GCCTGTAATCCCAGCACTGCAGG + Intronic
985403590 4:189615402-189615424 GCCAGCAGGGCCAGCACTGCTGG + Intergenic
986716502 5:10527869-10527891 GCCTGCAATCCCAGCACTTCTGG - Intergenic
989288941 5:39738943-39738965 GCCAGCAATCTCAGCACTGTGGG - Intergenic
989640094 5:43575831-43575853 GCCTGTAATGCCAGCACTTCGGG - Intergenic
989971515 5:50530809-50530831 GCGTGTAATCCCAGCACTTCAGG + Intergenic
990583306 5:57185526-57185548 GCCTGTAATCCCAGCACTGCAGG - Intronic
990824307 5:59879996-59880018 GCTTGCAATGCCAGCACTTTGGG - Intronic
991243654 5:64486421-64486443 GTGAACAATGCCAACACTCCTGG - Intergenic
992008904 5:72507895-72507917 GCGAGGAATTGCAGCAATGCTGG - Intergenic
992432649 5:76724328-76724350 GCCTGTAATGCCAGCACTTCGGG - Intronic
992889809 5:81193775-81193797 GCCAGTAATCCCAGCACTACGGG - Intronic
993091165 5:83428033-83428055 GCCAGTAATGCCAGCACTTTGGG - Intergenic
993398830 5:87423479-87423501 GCCTGTAATCCCAGCACTGCGGG - Intergenic
995499653 5:112790586-112790608 GCCTGCAATCCCAGCACTTCAGG - Intronic
995580018 5:113588882-113588904 GCGTGCAATCCCAGCACTTTGGG - Intronic
997065010 5:130549466-130549488 GGGAGAAATGCAGGCACTGCAGG - Intergenic
997613754 5:135232501-135232523 GCCAGTAATCCCAGCACTTCTGG + Intronic
998009941 5:138686802-138686824 GCCTGTAATCCCAGCACTGCGGG - Intronic
999163135 5:149522368-149522390 GCCAGCAATCCCAGCACTTTGGG - Intronic
999878739 5:155837415-155837437 GCCAGTAATCCCAGCACTTCAGG - Intergenic
999908165 5:156166577-156166599 GCCTGCAATCCCAGCACTGTGGG - Intronic
1000286004 5:159826680-159826702 GCGAGCATTGCCAGCAGAGTTGG - Intergenic
1001650435 5:173312069-173312091 CCGAGCAATGGCAGAGCTGCTGG + Intergenic
1002038199 5:176489804-176489826 GCCAGCAATCCCAGCACTTCGGG - Intronic
1002123798 5:177026262-177026284 GCGTGTAATGCCAGCACTTTGGG - Intronic
1002144546 5:177168718-177168740 GCCAGCAATCCCAGCACTTTGGG - Intronic
1002484897 5:179528424-179528446 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1002624690 5:180517386-180517408 GCCTGTAATCCCAGCACTGCAGG - Intronic
1002906119 6:1450629-1450651 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1003236162 6:4296829-4296851 GAGAGCAATGGCAGCACAGTTGG + Intergenic
1003310685 6:4967378-4967400 GCCTGTAATCCCAGCACTGCGGG + Intergenic
1004098219 6:12580723-12580745 GCCTGCAATGCCAGCACTTTGGG + Intergenic
1004794022 6:19061031-19061053 GCATGTAATGCCAGCACTTCGGG - Intergenic
1004948682 6:20644090-20644112 GCCTGTAATTCCAGCACTGCAGG - Intronic
1005046402 6:21646836-21646858 GCCTGCAATCCCAGCACTTCAGG - Intergenic
1005071614 6:21867136-21867158 GCCAGCAATCCCAGCACTTTGGG + Intergenic
1006482376 6:34307317-34307339 GCCTGCAATGCCAGCACTTTTGG + Intronic
1007115135 6:39337934-39337956 CCTGGAAATGCCAGCACTGCTGG - Intronic
1007528556 6:42519680-42519702 GCGTGCAATTCCAGCACTTTGGG - Intergenic
1007652154 6:43429643-43429665 GCCTGTAATGCCAGCACTGTAGG + Intronic
1007828864 6:44622743-44622765 GCGTGTAATCCCAGCACTGTGGG - Intergenic
1008947183 6:57111178-57111200 GCCTGCAATCCCAGCACTTCGGG - Intronic
1009908640 6:69899410-69899432 GCCTGCAATCCCAGCACTGTGGG - Intronic
1010439565 6:75877524-75877546 GCCTGCAATCCCAGCACTTCAGG - Intronic
1012563363 6:100615230-100615252 GCCTGTAATCCCAGCACTGCAGG - Intronic
1013245437 6:108282953-108282975 GCCTGCAATCCCAGCACTTCGGG - Intergenic
1013528383 6:110996446-110996468 GCCAGTAATCCCAGCACTGTGGG - Intronic
1015856798 6:137633432-137633454 GCCAGCAATCCCAGCACTTTGGG - Intergenic
1016567402 6:145471925-145471947 GCCAGCATTGCCAGCACTCCTGG - Intergenic
1017394862 6:153986538-153986560 GAGAGCAATGCCAGCACTTCGGG - Intergenic
1017667002 6:156729590-156729612 GCCTGCAATCCCAGCACTTCAGG + Intergenic
1018037745 6:159896047-159896069 GCCTGTAATCCCAGCACTGCGGG + Intergenic
1018396637 6:163382939-163382961 GCCAGCAATCCCAGCACTTTGGG + Intergenic
1019775718 7:2910965-2910987 GCCAGCAATCCCAGCACTTTGGG + Intronic
1019993036 7:4705439-4705461 GCCTGTAATCCCAGCACTGCGGG - Intronic
1020169019 7:5830731-5830753 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1020264980 7:6554356-6554378 GCCTGCAATCCCAGCACTGTCGG - Intergenic
1020618355 7:10488196-10488218 GCCAGCAATCCCAGCACTTTGGG - Intergenic
1021438669 7:20652306-20652328 GCGTGTAATCCCAGCACTGTGGG + Intronic
1021711794 7:23423032-23423054 GCCTGCAATCCCAGCACTTCGGG - Intronic
1022277570 7:28870651-28870673 GCCTGCAATCCCAGCACTTCGGG - Intergenic
1022741663 7:33128345-33128367 GCCAGCAATCCCAGCACTTTGGG + Intergenic
1023166027 7:37344289-37344311 GCCTGCAATCCCAGCACTTCAGG - Intronic
1023171168 7:37391373-37391395 GCCTGTAATGCCAGCACTTCGGG - Intronic
1023424100 7:40016075-40016097 GGGAGAAATGCCAGCAGTGAAGG + Intronic
1023440031 7:40175970-40175992 GCCGGTAATGCCAGCACTGTGGG + Intronic
1024797963 7:53040407-53040429 GCCAGTAATCCCAGCACTTCAGG - Intergenic
1025184273 7:56844931-56844953 GCCAGCAATCCCAGCACTTCAGG - Intergenic
1025218069 7:57077033-57077055 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1025602237 7:63011853-63011875 GCCTGCAATCCCAGCACTGTGGG + Intergenic
1025653275 7:63493421-63493443 GCCTGCAATCCCAGCACTTCGGG - Intergenic
1025687655 7:63732037-63732059 GCCAGCAATCCCAGCACTTCAGG + Intergenic
1027003524 7:74672277-74672299 GCCAGTAATCCCAGCACTTCGGG + Intronic
1027404366 7:77844251-77844273 GCCTGCAATCCCAGCACTTCGGG - Intronic
1027573918 7:79907760-79907782 GCCAGTAATGCCAGAACTTCGGG + Intergenic
1028496446 7:91466343-91466365 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1029372627 7:100158893-100158915 GCCAGTAATCCCAGCACTGTGGG + Intergenic
1029404026 7:100362766-100362788 GCCTGCAATGCCAGCACTTTGGG - Intronic
1030227936 7:107172849-107172871 GCCTGCAATGCCAGCACTTTGGG - Intronic
1031026949 7:116689817-116689839 GCCAGCAATCCCAGCACTTCAGG - Intronic
1031822657 7:126523754-126523776 GCCTGTAATGCCAGCACTTCGGG - Intronic
1031871844 7:127096298-127096320 GCCTGCAATGCCAGCACTTTGGG + Intronic
1031960729 7:127987335-127987357 TCAAGCAATGCCTGCACTGCTGG - Intronic
1032747098 7:134796843-134796865 GCCTGCAATCCCAGCACTGTGGG - Intronic
1033321213 7:140341190-140341212 GCCAGTAATCCCAGCACTTCGGG - Intronic
1033736042 7:144222773-144222795 GCCTGCAATCCCAGCACTTCGGG - Intergenic
1033747011 7:144328179-144328201 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1036390616 8:8321342-8321364 GCGAGTAATCCCAGCACTTTGGG - Intronic
1036759325 8:11496500-11496522 GCCTGCAATCCCAGCACTGTGGG - Intronic
1037185483 8:16057643-16057665 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1037276023 8:17179668-17179690 GCATGAAATGCCAGCACTTCGGG - Intronic
1037413401 8:18621146-18621168 GCCTGCAATCCCAGCACTTCGGG + Intronic
1038418124 8:27412499-27412521 GCCACCAATGTCACCACTGCTGG - Intronic
1038830077 8:31047385-31047407 GCCAGCAATCCCAGCACTTTGGG - Intronic
1039001943 8:32991186-32991208 GCCTGCAATCCCAGCACTTCAGG - Intergenic
1039563545 8:38532118-38532140 GCCTGCAATCCCAGCACTGTGGG + Intergenic
1039683183 8:39764752-39764774 GCGAGTAATCCCAGCACTTCGGG + Intronic
1039827968 8:41190943-41190965 GCGCTCAATGCCAGGCCTGCTGG - Intergenic
1039901602 8:41756700-41756722 GCCTGTAATGCCAGCACTCCAGG - Intronic
1040933708 8:52762169-52762191 GCCAGTAATCCCAGCACTGTGGG - Intergenic
1040988943 8:53328309-53328331 GAGAGCACTCCCTGCACTGCAGG - Intergenic
1041067717 8:54098417-54098439 GCCTGTAATCCCAGCACTGCGGG + Intronic
1041757539 8:61330828-61330850 GCCTGCAATCCCAGCACTGTGGG + Intronic
1042043856 8:64625230-64625252 GCCTGTAATGCCAGCACTTCGGG - Intronic
1043827380 8:84945959-84945981 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1046427755 8:114077554-114077576 GCGTGTAATCCCAGCACTTCGGG + Intergenic
1046661190 8:116949930-116949952 GAGCGCAGTGCCGGCACTGCTGG + Intergenic
1047145932 8:122199250-122199272 GCGAGTAATCCCAGCACTTTGGG - Intergenic
1047950492 8:129929951-129929973 GCGTGCAATCCCAGCACTTTGGG + Intronic
1048310396 8:133318032-133318054 GCCAGTAATCCCAGCACTCCGGG - Intergenic
1048510360 8:135056357-135056379 GCCAGTAATCCCAGCACTTCGGG + Intergenic
1049214123 8:141399824-141399846 ACGTGCAATGGCAGCACTGCGGG + Intronic
1049755050 8:144307478-144307500 GCCTGTAATCCCAGCACTGCAGG + Intronic
1049761691 8:144334553-144334575 GCGCACAAAGCCAGGACTGCCGG + Intronic
1049764723 8:144349488-144349510 GCCTGCAATCCCAGCACTTCAGG + Intergenic
1049764738 8:144349555-144349577 GCCTGCAATCCCAGCACTTCAGG + Intergenic
1049783835 8:144441096-144441118 CGGACCACTGCCAGCACTGCCGG + Exonic
1049872528 8:144992100-144992122 GCCTGCAATCCCAGCACTTCAGG + Intergenic
1049980669 9:901274-901296 GCCTGCAATCCCAGCACTGTGGG - Intronic
1050544256 9:6696319-6696341 GCGTGTAATCCCAGCACTTCGGG - Intergenic
1050687014 9:8183148-8183170 GCCACCAATGCCTGCATTGCTGG + Intergenic
1051387493 9:16524812-16524834 GCCAGCAATCCCAGCACTTTGGG + Intronic
1052708204 9:32019004-32019026 GCCTGCAATTCCAGCACTGTGGG + Intergenic
1052726383 9:32232995-32233017 GCCTGTAATGCCAGCACTTCGGG + Intergenic
1052853557 9:33392966-33392988 GCCAGCAATCCCAGCACTTTGGG + Intronic
1052970381 9:34373710-34373732 GCCTGTAATGCCAGCACTTCTGG - Intronic
1053681580 9:40489121-40489143 GCCAGCAATCCCAGCACTTTGGG + Intergenic
1053931573 9:43117451-43117473 GCCAGCAATCCCAGCACTTTGGG + Intergenic
1054282133 9:63135813-63135835 GCCAGCAATCCCAGCACTTTGGG - Intergenic
1054294671 9:63324638-63324660 GCCAGCAATCCCAGCACTTTGGG + Intergenic
1054352593 9:64030783-64030805 GCCTGTAATCCCAGCACTGCAGG - Intergenic
1054392691 9:64629125-64629147 GCCAGCAATCCCAGCACTTTGGG + Intergenic
1054427341 9:65134334-65134356 GCCAGCAATCCCAGCACTTTGGG + Intergenic
1054503036 9:65887206-65887228 GCCAGCAATCCCAGCACTTTGGG - Intronic
1054837070 9:69687075-69687097 GCCTGTAATGCCAGCACTTCGGG - Intergenic
1055077999 9:72237037-72237059 GCCTGCAATCCCAGCACTGTGGG - Intronic
1057197829 9:93124851-93124873 GCGAGCAACCCCAGGACTGCAGG + Intronic
1059058870 9:111014317-111014339 GAGAGAAATGGCAGCACTGATGG - Intronic
1059209972 9:112504446-112504468 GCCTGCAATTCCAGCACTTCGGG - Intronic
1059717682 9:116929009-116929031 GTGAGGAATGCCAGAAATGCAGG - Intronic
1060623767 9:125091850-125091872 GCCTGTAATCCCAGCACTGCGGG + Intronic
1060728291 9:126020823-126020845 GCCTGCAATCCCAGCACTTCAGG - Intergenic
1060881377 9:127120562-127120584 GCCTGCAATCCCAGCACTTCGGG + Intronic
1061321419 9:129832696-129832718 GCCTGTAATGCCAGCACTTCAGG - Intronic
1061680191 9:132239194-132239216 GTCAGCACTGCCAGCACTGCCGG + Exonic
1062096021 9:134703896-134703918 GCCTGCAATCCCAGCACTGTGGG - Intronic
1062438121 9:136556062-136556084 GCCAGAAATCCCAGCACTTCGGG - Intergenic
1202803221 9_KI270720v1_random:21879-21901 GCCAGCAATCCCAGCACTTTGGG + Intergenic
1185612218 X:1399440-1399462 GCCTGCAATGCCAGCACTTTAGG + Intergenic
1185746469 X:2577391-2577413 GCCTGCAATCCCAGCACTTCGGG - Intergenic
1186591828 X:10938753-10938775 ACGAACAAGGCCAACACTGCAGG + Intergenic
1187056095 X:15742636-15742658 GCGTGTAATTCCAGCACTTCGGG - Intronic
1187343000 X:18438321-18438343 GCCTGCAATCCCAGCACTGTGGG - Intronic
1188475082 X:30583444-30583466 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1188930908 X:36109731-36109753 GCCTGCAATCCCAGCACTGTGGG - Intronic
1189439024 X:41017939-41017961 GCCTGTAATGCCAGCACTTCGGG + Intergenic
1190343915 X:49320520-49320542 GCCAGTAATCCCAGCACTGTGGG - Intergenic
1190345010 X:49330064-49330086 GCCAGTAATCCCAGCACTGTGGG - Intergenic
1190346104 X:49339629-49339651 GCCAGTAATCCCAGCACTGTGGG - Intergenic
1190347358 X:49530660-49530682 GCCAGTAATCCCAGCACTGTGGG - Intergenic
1190348457 X:49540216-49540238 GCCAGTAATCCCAGCACTGTGGG - Intergenic
1190349558 X:49549772-49549794 GCCAGTAATCCCAGCACTGTGGG - Intergenic
1190350662 X:49559325-49559347 GCCAGTAATCCCAGCACTGTGGG - Intronic
1190351764 X:49568883-49568905 GCCAGTAATCCCAGCACTGTGGG - Intergenic
1190352864 X:49578432-49578454 GCCAGTAATCCCAGCACTGTGGG - Intergenic
1190353965 X:49587979-49588001 GCCAGTAATCCCAGCACTGTGGG - Intergenic
1190355067 X:49597503-49597525 GCCAGTAATCCCAGCACTGTGGG - Intronic
1192120926 X:68454943-68454965 GCCTGCAATGCCAGCACTTTGGG + Intergenic
1192365020 X:70464518-70464540 GCCTGTAATCCCAGCACTGCTGG - Intronic
1196681808 X:118477054-118477076 GCCTGCAATCCCAGCACTTCGGG - Intergenic
1196732727 X:118957498-118957520 GCCAGTAATCCCAGCACTTCGGG + Intergenic
1196834616 X:119802705-119802727 GCTTGAAATGCCAGCACTTCGGG - Intergenic
1198156136 X:133962578-133962600 GAGAACAATGCCAGCTATGCTGG + Intronic
1198761292 X:140035382-140035404 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1198884039 X:141314069-141314091 GCCTGTAATGCCAGCACTGTGGG + Intergenic
1198919641 X:141711102-141711124 GCCTGCAATGCCAGCACTTTGGG + Intergenic
1199743096 X:150754198-150754220 GTAATCAATGCCAGCAGTGCTGG - Intronic
1199970503 X:152856795-152856817 GCCTGCAATGCCAGCACTTTGGG + Intronic
1200765341 Y:7076186-7076208 ACCTGCAATGCCAGCACTGTGGG - Intronic
1201780783 Y:17720074-17720096 GCCTGCAATCCCAGCACTTCGGG + Intergenic
1201820770 Y:18185916-18185938 GCCTGCAATCCCAGCACTTCGGG - Intergenic
1202598554 Y:26569173-26569195 GCCAGTAATCCCAGCACTTCGGG - Intergenic