ID: 1169172992

View in Genome Browser
Species Human (GRCh38)
Location 20:3480594-3480616
Sequence CCTAACATACAGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 331}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169172985_1169172992 1 Left 1169172985 20:3480570-3480592 CCTTCCACTTACAGTAGAACAAT 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1169172992 20:3480594-3480616 CCTAACATACAGAGGGAGGGAGG 0: 1
1: 0
2: 2
3: 35
4: 331
1169172984_1169172992 19 Left 1169172984 20:3480552-3480574 CCGGTTAGAGTTGGATTTCCTTC 0: 1
1: 0
2: 2
3: 26
4: 209
Right 1169172992 20:3480594-3480616 CCTAACATACAGAGGGAGGGAGG 0: 1
1: 0
2: 2
3: 35
4: 331
1169172986_1169172992 -3 Left 1169172986 20:3480574-3480596 CCACTTACAGTAGAACAATTCCT 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1169172992 20:3480594-3480616 CCTAACATACAGAGGGAGGGAGG 0: 1
1: 0
2: 2
3: 35
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169172992 Original CRISPR CCTAACATACAGAGGGAGGG AGG Intronic
900673470 1:3869903-3869925 CCTCACATTCCCAGGGAGGGCGG + Intronic
900986168 1:6073883-6073905 CAAAACAGAAAGAGGGAGGGAGG - Intronic
902125444 1:14206486-14206508 CATTACATTCAGAGAGAGGGAGG - Intergenic
904043559 1:27597774-27597796 CCAGACAGACAGAGAGAGGGAGG - Intronic
904450825 1:30610165-30610187 CCTCCGAAACAGAGGGAGGGGGG - Intergenic
904820002 1:33235879-33235901 CCTGACCAACAGAAGGAGGGAGG - Intergenic
908038716 1:60084348-60084370 ACTGACAGAGAGAGGGAGGGAGG - Intergenic
909694661 1:78453384-78453406 GCTAACCTACAGAGGAAAGGTGG - Intronic
913174006 1:116257278-116257300 TCTAAAACTCAGAGGGAGGGAGG - Intergenic
915979452 1:160410889-160410911 CCCAGCATCCAAAGGGAGGGAGG - Intronic
916417811 1:164609331-164609353 CCTAACATGCTGAAGCAGGGTGG - Intronic
917374183 1:174331158-174331180 ACTTACATACAGAGAGAGAGAGG - Intronic
918185842 1:182127191-182127213 CTTAATAAACAGAGGGTGGGGGG - Intergenic
919677751 1:200402457-200402479 GCTAACGTACAGGGGGCGGGGGG + Intergenic
920449398 1:206047806-206047828 CCTAGGATGCAGAAGGAGGGAGG - Intronic
920718953 1:208368950-208368972 CCATACTTACAGAGGTAGGGAGG + Intergenic
921086522 1:211798932-211798954 CCTAGAAAAGAGAGGGAGGGAGG + Intronic
921294483 1:213689166-213689188 TCTAACATCCAGAAAGAGGGAGG - Intergenic
923784511 1:237054334-237054356 CCTGACAGATGGAGGGAGGGGGG - Intronic
924859934 1:247910542-247910564 CCTAACATCCGGCGGGGGGGCGG + Intergenic
1064396100 10:14983335-14983357 CCTAATATCCAGAGGGGGAGAGG + Intronic
1064396893 10:14989642-14989664 CCTAATATCCACAGGGAGAGAGG + Intergenic
1064396902 10:14989717-14989739 CCTAACATCCAGAGTGAAAGAGG + Intergenic
1064399811 10:15012112-15012134 CCTAATATCCACAGGGAGAGAGG + Intergenic
1064399822 10:15012187-15012209 CCTAACATCCAGAGTGAAAGAGG + Intergenic
1065607427 10:27432640-27432662 ACTCACATGGAGAGGGAGGGAGG - Intergenic
1069021635 10:63494946-63494968 TCTCACATACAGAGGGAAGTGGG - Intergenic
1069224330 10:65923039-65923061 CCCCACATATTGAGGGAGGGAGG - Intronic
1069640022 10:69948812-69948834 TGTCACAGACAGAGGGAGGGTGG + Intronic
1072963622 10:99952813-99952835 CCTAAAGTAGAAAGGGAGGGAGG + Intronic
1073165421 10:101444890-101444912 CCTAACAAAATGAGGGAGGGTGG - Intronic
1076437978 10:130459547-130459569 CCTAAGGTGAAGAGGGAGGGGGG + Intergenic
1076438039 10:130459806-130459828 CCTAAGGTGAAGAGGGAGGGGGG + Intergenic
1079038707 11:17042705-17042727 CCTAATATCCAGGGGGAGAGAGG - Intergenic
1079038733 11:17042819-17042841 CCTAATATCCAGAGGGCGAGAGG - Intergenic
1080406157 11:31981352-31981374 ATTAACAGCCAGAGGGAGGGGGG - Intronic
1081448737 11:43153380-43153402 CCTAATATCCAGAGGGGGAGTGG + Intergenic
1081450827 11:43169494-43169516 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1082936734 11:58663624-58663646 CCTAATATCCAAAGGGAGAGAGG - Intronic
1082936807 11:58664117-58664139 CCTAATATCCAGGGGGAGAGAGG - Intronic
1083140073 11:60714473-60714495 CCCCACATTCAGAGGGATGGTGG + Intronic
1084227374 11:67725623-67725645 CCTAATATCCACAGGGAGAGAGG + Intergenic
1084227386 11:67725698-67725720 CCTAACATCCAGAGCGAAAGAGG + Intergenic
1084260791 11:67977320-67977342 CCTTATATCCAGAGGGAGAGAGG + Intergenic
1084260804 11:67977395-67977417 CCTAATATCCACAGGGAGAGAGG + Intergenic
1084811849 11:71616797-71616819 CCTAATATCCACAGGGAGAGAGG - Intergenic
1084844934 11:71891243-71891265 CCTAATATCCACAGGGAGAGAGG - Intronic
1084847698 11:71913207-71913229 CCTAATATCCACAGGGAGAGAGG - Intronic
1086407818 11:86514010-86514032 CCCCACATGCAGAGAGAGGGAGG + Intronic
1086938379 11:92768663-92768685 GCTAACATACAGAGGAAAGAGGG + Intronic
1087266587 11:96068468-96068490 ACACACACACAGAGGGAGGGAGG + Intronic
1088456363 11:110036748-110036770 CTTAACTAACAGAGGGTGGGGGG - Intergenic
1088755777 11:112884005-112884027 ATTAACATAGAGAGTGAGGGGGG + Intergenic
1089356673 11:117858407-117858429 CCTGACATGGAGAGGGAGTGAGG - Intronic
1089654678 11:119938442-119938464 CCCAACATGGAGAGGGAGGGAGG - Intergenic
1092432051 12:8417871-8417893 CCTAATATCCACAGGGAGAGAGG + Intergenic
1092432062 12:8417946-8417968 CCTAACATCCAGAGCGAAAGAGG + Intergenic
1092435558 12:8444385-8444407 CCTAATATCCAGAGGGGGAGAGG + Intergenic
1093318624 12:17683846-17683868 TCTTACATACAGAGGAAAGGTGG - Intergenic
1093512622 12:19947135-19947157 CCTGTCAGACAGCGGGAGGGTGG - Intergenic
1094225459 12:28040291-28040313 ACTAAAATATAGAGGGATGGTGG + Intergenic
1096038346 12:48492544-48492566 CCTAAAAGATGGAGGGAGGGAGG + Intronic
1096506843 12:52099080-52099102 CCTCATATCCAGAGGGAGAGAGG - Intergenic
1096506890 12:52099377-52099399 CCTAATATCCAGGGGGAGAGAGG - Intergenic
1096506913 12:52099475-52099497 CCTAATATCCAGAGGGCGAGAGG - Intergenic
1096508686 12:52114759-52114781 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1096508698 12:52114833-52114855 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1097434960 12:59544749-59544771 CCTAATATACAGCGGGAAAGGGG + Intergenic
1097436310 12:59554074-59554096 CCTAATATTTAGAGGGAGAGAGG + Intergenic
1098479519 12:70942762-70942784 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1099071166 12:78047536-78047558 CCTAAAAGCCAGAGGGAGTGAGG - Intronic
1099181412 12:79475338-79475360 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1100018444 12:90040715-90040737 ACTAACAGAAAGAGGGAGAGAGG + Intergenic
1100818891 12:98412664-98412686 TCCCACAGACAGAGGGAGGGAGG + Intergenic
1101918686 12:108915749-108915771 CCCCAAATACAGAGGGATGGGGG - Intronic
1102446478 12:113006860-113006882 CCTTGCCTACAGAGGGTGGGTGG + Intronic
1102945707 12:116986179-116986201 CCCAACAGACAGAAAGAGGGAGG - Intronic
1105484311 13:20811794-20811816 CCTACAATACAGAAGGATGGGGG + Intronic
1105801863 13:23911936-23911958 CCTAATATACAGAGAGAGGTGGG - Intergenic
1106539769 13:30679933-30679955 CCTAAATTACAGATAGAGGGAGG + Intergenic
1106674282 13:31941383-31941405 CCTGCCAAAGAGAGGGAGGGAGG + Intergenic
1106789792 13:33143017-33143039 CCTCACATGCAGAGAGAGAGAGG - Intronic
1107548518 13:41455473-41455495 CCTACTATCCAGAGGGAGAGAGG - Intergenic
1108423666 13:50276459-50276481 GCCCACATACAGAGAGAGGGTGG - Intronic
1109355961 13:61230206-61230228 CCTAATATCCAGAAGGAGAGAGG - Intergenic
1109882650 13:68500878-68500900 CATAAAATACATAGGGAAGGTGG - Intergenic
1110237535 13:73232360-73232382 CATAACATCTAGAGTGAGGGAGG - Intergenic
1110451835 13:75645373-75645395 CATAACATTCAAAGGAAGGGAGG + Intronic
1112428135 13:99323682-99323704 GGTAGCATAGAGAGGGAGGGAGG - Intronic
1114437020 14:22714854-22714876 CCTAATATCCAGAGCGAGAGAGG + Intergenic
1116516904 14:45815421-45815443 CCTAATATTCAGAGGGAGATAGG + Intergenic
1116517425 14:45818534-45818556 CCTAATATCCAGAGGGAGAGAGG - Intergenic
1116517906 14:45821765-45821787 CCTAATATACAGTGGAAGAGAGG + Intergenic
1116519297 14:45830752-45830774 CCTAATATCCAGTGGGAGAGAGG + Intergenic
1116519437 14:45831682-45831704 CCTAATATCCAGAGGGAGATAGG - Intergenic
1116942833 14:50808228-50808250 CCAAACATCCTGGGGGAGGGAGG + Intronic
1117039123 14:51753723-51753745 CCTAATATCCACAGGGAGAGAGG - Intergenic
1118830297 14:69425177-69425199 CACATCCTACAGAGGGAGGGAGG + Intronic
1119582738 14:75801604-75801626 CACAAAATACAGAGGGTGGGGGG - Intronic
1119942900 14:78659964-78659986 CATAACATACAGAGGCACAGAGG + Intronic
1120490514 14:85173109-85173131 GCCAACATAGAGAGGGGGGGGGG + Intergenic
1120694267 14:87626662-87626684 CATAAAATATAGAGGGAGAGAGG - Intergenic
1120768928 14:88357843-88357865 CCCCACATATGGAGGGAGGGAGG + Intergenic
1121374858 14:93399200-93399222 CCCCACATGTAGAGGGAGGGAGG - Intronic
1122749732 14:103923917-103923939 ACACACACACAGAGGGAGGGGGG + Intronic
1125825423 15:42672348-42672370 CCCTACATAAAGAGGCAGGGTGG + Intronic
1125967678 15:43887356-43887378 CCTCACAGGCAAAGGGAGGGTGG + Intronic
1127702038 15:61510765-61510787 TCTGACACACAGATGGAGGGAGG - Intergenic
1128576005 15:68775634-68775656 CCTAAGACCCAGAGGGATGGGGG + Intergenic
1129185689 15:73904854-73904876 CAAAACACACAGATGGAGGGAGG + Intergenic
1129797489 15:78389207-78389229 ACTAAAGTACAGAGGGAAGGGGG - Intergenic
1130642940 15:85696407-85696429 CCTAACATAAAGACTGAGCGAGG + Intronic
1134257389 16:12623447-12623469 CTTTACATAGAGAGGGAGGCAGG - Intergenic
1135697910 16:24606452-24606474 CCTAACATTTAGAGGGAGAGAGG - Intergenic
1137065995 16:35843960-35843982 AGTTAGATACAGAGGGAGGGAGG + Intergenic
1138235005 16:55374687-55374709 ACTGACACACAGAGGGAGGAAGG + Intergenic
1139182289 16:64762384-64762406 ATTAACATAATGAGGGAGGGTGG + Intergenic
1139248137 16:65468340-65468362 CCCAACATAAGGAGGGAGGCAGG + Intergenic
1140741746 16:77947754-77947776 CCTCAAAAACAGAGGGAGGTAGG - Intronic
1144872799 17:18381140-18381162 CCTAACACACGGTGGGAGAGAGG + Intronic
1146037499 17:29420517-29420539 CCTAAAGTACAGTGTGAGGGTGG + Intronic
1146397940 17:32483771-32483793 CATAGCATCCCGAGGGAGGGAGG - Intergenic
1146820682 17:35981817-35981839 CCCAACATACAGATGGTGGCAGG - Intergenic
1147142748 17:38468514-38468536 CCTACCAGACAGTGAGAGGGAGG + Intronic
1148789249 17:50164200-50164222 TCTCAGAGACAGAGGGAGGGAGG - Intronic
1148973003 17:51500650-51500672 CCAAGCATACAGAGAGAGAGAGG - Intergenic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1151399476 17:73846558-73846580 CCAAACATACAGAGGGGAGGTGG - Intergenic
1151538798 17:74753725-74753747 CCAAAAAAACAGGGGGAGGGGGG + Intronic
1151694513 17:75707337-75707359 GATAACACACAGAGGAAGGGTGG - Exonic
1151748449 17:76023859-76023881 CCTAACACACGGTGGGAGAGAGG - Intronic
1151933533 17:77247784-77247806 CCTCACATGGAGGGGGAGGGAGG - Intergenic
1152404600 17:80089552-80089574 TCTGGCATACAGGGGGAGGGAGG - Intronic
1155623068 18:27803251-27803273 CCCCACATGTAGAGGGAGGGAGG + Intergenic
1156191721 18:34727936-34727958 CCTAATATTAAGAGGGAGGGGGG + Intronic
1157283988 18:46364731-46364753 GCTCACATACTGATGGAGGGTGG + Intronic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1158060981 18:53341206-53341228 CTCAACAGACAGAGGGAGGGAGG + Intronic
1158721163 18:59925919-59925941 CCTAACATACAGGGAGAAAGGGG - Intergenic
1158795277 18:60838488-60838510 CAAAACATACACAGGGAGGGGGG - Intergenic
1160107607 18:75992959-75992981 CTTAACATACAGGGGGAGAAAGG + Intergenic
1161877009 19:6919431-6919453 ACACACACACAGAGGGAGGGAGG - Intronic
1163821637 19:19499541-19499563 CCCAGGATACAGAGGGAGGAGGG + Intronic
1164520928 19:28978936-28978958 CCCAAAATACAGTGGCAGGGAGG + Intergenic
1165395968 19:35563680-35563702 CCTGATATACCCAGGGAGGGCGG + Intergenic
1166201208 19:41238945-41238967 CCTGACATAGGGAGGGAGGATGG + Intronic
1166237040 19:41464246-41464268 CCTAATATCCAGGGGGAGAGAGG - Intergenic
1166237360 19:41466259-41466281 TCTAATATACAGAGGGGGAGAGG - Intergenic
1166237791 19:41469065-41469087 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1166244768 19:41517584-41517606 CATAATATATAGAGGGAGAGAGG - Intergenic
1167315582 19:48761159-48761181 CCCAACATCCAGAGAGAAGGGGG + Intergenic
1167571344 19:50290822-50290844 CCTAGCACACAGAGGGAGGCTGG + Intronic
1167685713 19:50954789-50954811 CCTAAAATGCAGGGAGAGGGAGG - Intergenic
925122708 2:1431885-1431907 TCTAACTTGCAGAGGGAAGGAGG + Intronic
925817805 2:7770166-7770188 CCCCACATATTGAGGGAGGGAGG - Intergenic
927128520 2:20036226-20036248 GCTGGCACACAGAGGGAGGGTGG - Intronic
927742236 2:25581925-25581947 CCCACCATTCAGAGGCAGGGTGG + Intronic
928947013 2:36780791-36780813 GCTAAAATAGAGAAGGAGGGAGG + Intronic
929977705 2:46651479-46651501 ACGAAAATGCAGAGGGAGGGCGG + Intergenic
930283577 2:49400682-49400704 CCTCACATACAGATGGAGATAGG + Intergenic
930811625 2:55547665-55547687 CATAAGATACAGAGATAGGGAGG + Intronic
932216094 2:69966853-69966875 CCTAACATACAGAAGATGGGGGG + Intergenic
932350279 2:71025639-71025661 CCTAACATCCACAGGGAGAGAGG - Intergenic
932350293 2:71025714-71025736 CCTAACATCCAGAGGGAGAGAGG - Intergenic
932352829 2:71045900-71045922 CCTACTATCCAGAGGGAGGGAGG - Intergenic
932353767 2:71051771-71051793 CCTAATATCCACAGGGAGAGAGG - Intergenic
932353780 2:71051845-71051867 CCTTATATCCAGAGGGAGAGGGG - Intergenic
933234540 2:79850370-79850392 AGAAACAAACAGAGGGAGGGAGG - Intronic
933391161 2:81669137-81669159 ACACACACACAGAGGGAGGGAGG - Intergenic
937971377 2:127551942-127551964 CCTTACAGACAGGGGCAGGGTGG - Intronic
938595695 2:132785120-132785142 CCTCAGGTACAGAGGGAGAGGGG - Exonic
940871640 2:158865521-158865543 CCTAATATCCAGAGGGGGAGAGG - Intergenic
940872514 2:158871411-158871433 CCTAATATCCACAGGGAGAGAGG - Intergenic
940872528 2:158871486-158871508 CCTAATATCCAGAGGGAGAGAGG - Intergenic
940873734 2:158881127-158881149 CCTAATATCCACAGGGAGAGAGG - Intergenic
940873750 2:158881202-158881224 CCTACTATCCAGAGGGAGAGAGG - Intergenic
940874711 2:158887395-158887417 CCTAATATCCACAGGGAGAGAGG - Intergenic
940874726 2:158887470-158887492 CCTAATACCCAGAGGGAGAGAGG - Intergenic
941533173 2:166693820-166693842 CCTAATATCCAGAGGGAGAGAGG - Intergenic
941778367 2:169417329-169417351 CAGAAAATTCAGAGGGAGGGAGG + Intergenic
942161762 2:173196326-173196348 CCTGACCTACACAGGGAGGGAGG - Intronic
942317007 2:174706130-174706152 CCTAATATACAGGGGGAAAGAGG - Intergenic
942398302 2:175575370-175575392 CTTCACATGGAGAGGGAGGGAGG - Intergenic
946718810 2:222582436-222582458 CATAACCTATAGAGGCAGGGAGG + Intronic
946724831 2:222652073-222652095 CCTAACATACAGTGGTGGGATGG - Intronic
946888238 2:224246309-224246331 CATAACAGACTGAGGGTGGGCGG - Intergenic
947533677 2:230928000-230928022 CCTAAGAGACACGGGGAGGGAGG + Intronic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG + Intergenic
1169172992 20:3480594-3480616 CCTAACATACAGAGGGAGGGAGG + Intronic
1169456100 20:5753877-5753899 TCTCCCATGCAGAGGGAGGGGGG - Intronic
1171982592 20:31638276-31638298 CCCAACAAATAGAGTGAGGGAGG - Intronic
1172061112 20:32188168-32188190 CCTAACAGGTAGAGGCAGGGGGG + Intergenic
1172895169 20:38295201-38295223 CCTAAGATGCTGTGGGAGGGAGG + Intronic
1175675301 20:60941628-60941650 ACACACACACAGAGGGAGGGAGG - Intergenic
1178912242 21:36684487-36684509 GCTAACAGAGAGAGGAAGGGAGG - Intergenic
1179080336 21:38164963-38164985 CCAAACATGGGGAGGGAGGGAGG + Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1180657554 22:17435968-17435990 CGAGACAGACAGAGGGAGGGAGG - Intronic
1182133653 22:27879848-27879870 ACTAACATTCAGAGTGAGAGAGG - Intronic
1183078166 22:35439657-35439679 CCTAAAAGACAGAGTGGGGGTGG - Intergenic
1183116005 22:35693293-35693315 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1183116951 22:35699667-35699689 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1184123597 22:42471023-42471045 CCTGAGATACAGAGGGAGCTGGG - Intergenic
1184884629 22:47335196-47335218 CCTAAAATACTGGAGGAGGGGGG - Intergenic
949819622 3:8102252-8102274 GCAAACACACAGAGGGAGGGAGG + Intergenic
949884894 3:8684979-8685001 CCTAATATCCACAGGGAGAGAGG - Intronic
949884908 3:8685054-8685076 CCTCATATCCAGAGGGAGAGAGG - Intronic
951926172 3:27910876-27910898 ACAAACATACAGAGATAGGGAGG - Intergenic
952059805 3:29494273-29494295 CCTAACTTACAGGGTGTGGGTGG - Intronic
952919192 3:38273388-38273410 ACGCACACACAGAGGGAGGGAGG - Intronic
955496453 3:59538299-59538321 ACACACACACAGAGGGAGGGAGG - Intergenic
955830485 3:62996390-62996412 ACGGACAGACAGAGGGAGGGAGG + Intergenic
957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG + Intergenic
957044068 3:75360690-75360712 CCTAATATCCACAGGGAGAGAGG + Intergenic
957075861 3:75602871-75602893 CCTAATATCCACAGGGAGAGAGG + Intergenic
957713342 3:83892676-83892698 CACAGCATACAAAGGGAGGGAGG - Intergenic
959982197 3:112528848-112528870 CCTAATATCCAGAGGGAGAGAGG + Intergenic
959982267 3:112529240-112529262 CCTAATATCCAGAGGGAGAGAGG + Intergenic
959982281 3:112529315-112529337 CCTAATATCCAGAGGGAGAGAGG + Intergenic
960332916 3:116384560-116384582 CCTAGGATACAGAGTGAGGTGGG + Intronic
961272572 3:125700074-125700096 CCTAATATACCCAGGGAGAGAGG - Intergenic
961278339 3:125744933-125744955 CCTAATATCCACAGGGAGAGAGG - Intergenic
961278353 3:125745008-125745030 CCTTATATCCAGAGGGAGAGAGG - Intergenic
961876055 3:130024723-130024745 CCTAATATCCACAGGGAGAGAGG + Intergenic
963963838 3:151342531-151342553 ACTAAAATACAGATGCAGGGTGG - Intronic
964888954 3:161515891-161515913 CCTAATATCCAGAGGGGGAGAGG - Intergenic
965631166 3:170734392-170734414 CCCAAGCTACAGAGGGAGAGAGG - Intronic
968886903 4:3339877-3339899 CCTAACAAACAGAGCTGGGGAGG - Intronic
969024030 4:4159572-4159594 CCTAATATCCACAGGGAGAGAGG + Intergenic
969024041 4:4159647-4159669 CCTAACATCCAGAGCGAAAGAGG + Intergenic
969025008 4:4166059-4166081 CCTAATATCCACAGGGAGAGAGG + Intergenic
969729791 4:8947497-8947519 CCTAACATCCAGAGCGAAAGAGG - Intergenic
969734547 4:8978249-8978271 CCTAATATCCACAGGGAGAGAGG - Intergenic
969785958 4:9457124-9457146 CCTAATATCCACAGGGAGAGAGG - Intergenic
969792968 4:9504912-9504934 CCTAATATCCAGGGGGAGAGAGG + Intergenic
975322360 4:73023191-73023213 CCTAAAATGGAGAAGGAGGGAGG - Intergenic
976419132 4:84818152-84818174 CCTACCATATAGAGGTAAGGCGG + Intronic
977428797 4:96904561-96904583 CTAAACATGGAGAGGGAGGGAGG + Intergenic
980413752 4:132458325-132458347 CCTACCCTACAGAGGCAGGCAGG - Intergenic
980993523 4:139759266-139759288 AATAACATCCAGAGGGATGGGGG + Intronic
983491802 4:168398134-168398156 CCAAACCTGCAGAGGGAAGGGGG - Intronic
983623401 4:169782938-169782960 CATAACATCCAGAGGGGGAGGGG + Intergenic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
987438021 5:17921812-17921834 ACCAAGATACAGAGGTAGGGAGG + Intergenic
990861469 5:60332327-60332349 CCGAAAACAGAGAGGGAGGGGGG - Intronic
992597612 5:78361301-78361323 CCTAACAGAAAGAGGGGGGATGG - Intronic
993187346 5:84636440-84636462 CCTAACATCCATAGGGTGGGTGG - Intergenic
994391505 5:99197611-99197633 CATAACATAAAGGGGAAGGGAGG - Intergenic
994393545 5:99210692-99210714 CCTAATATACAGGGCGAGAGAGG - Intergenic
994394989 5:99220076-99220098 CCTAACATCCAGAGGGGAAGAGG - Intergenic
994396282 5:99228105-99228127 CCTAATATCCAGAGGGTGAGAGG - Intergenic
994811703 5:104527718-104527740 CCCAGCATACAGAGGGAATGTGG + Intergenic
995714890 5:115072661-115072683 ACTCCCATACAGAGGGAGGAGGG + Intergenic
996432725 5:123399748-123399770 ACCGACATACAGAGGGAGGTGGG + Intronic
996508587 5:124294217-124294239 CCTCACATGTTGAGGGAGGGAGG + Intergenic
997687803 5:135800854-135800876 CGTAACATCCAGAGGGGGAGAGG + Intergenic
1000368166 5:160510204-160510226 CCCAAAAGACAGAGGGAGAGAGG + Intergenic
1000825289 5:166037266-166037288 CCCAGCAGTCAGAGGGAGGGAGG - Intergenic
1001222673 5:169915592-169915614 ACACACACACAGAGGGAGGGAGG + Intronic
1001670353 5:173468453-173468475 CTTGACATCCAGAGGGATGGTGG + Intergenic
1002016535 5:176328363-176328385 GCTTACATACAGAGAGTGGGTGG + Intronic
1002407268 5:179044898-179044920 CCTAAACTCCAGAGGGAGGAGGG + Intergenic
1003974776 6:11331893-11331915 CCAGACATACAGAGGGCTGGAGG + Intronic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006342115 6:33452636-33452658 CCCAACACACTGGGGGAGGGGGG - Exonic
1006449690 6:34098935-34098957 CCCAGCCCACAGAGGGAGGGAGG - Intronic
1007501782 6:42304061-42304083 CTTATCATACATTGGGAGGGAGG - Intronic
1009046517 6:58242171-58242193 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1009046616 6:58242776-58242798 CCTAACATCCAGAGGAAAAGAGG + Intergenic
1009047610 6:58248847-58248869 CATAATATGCAGAGGGAGAGAGG + Intergenic
1009222172 6:60995503-60995525 CCTAATATCCAGAGGGGGAGAGG + Intergenic
1009222332 6:60996487-60996509 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1009222426 6:60997088-60997110 CCTAACATCCAGAGGAAAAGAGG + Intergenic
1009226478 6:61024516-61024538 CCTAATATTCAGAGGGGGAGAGG + Intergenic
1009226511 6:61024812-61024834 CCTAATATCCAGAGGTGGGGAGG + Intergenic
1009362770 6:62835581-62835603 CCTAATTTCCAGAGGGAGGGAGG + Intergenic
1009364667 6:62848718-62848740 CCTAATATACAGGGGGCGCGAGG + Intergenic
1009365511 6:62854792-62854814 CCTAATATCCAGACGGAGAGAGG + Intergenic
1009368587 6:62875187-62875209 CCTAATATTCAGAGGGGGAGAGG + Intergenic
1009369057 6:62878819-62878841 CCTAACTTCCAGGGGGAGAGAGG + Intergenic
1009369088 6:62879048-62879070 CCTAATATCTAGAGGAAGGGAGG + Intergenic
1009369199 6:62879850-62879872 CCTAATATTCAGAGGGAAAGAGG + Intergenic
1009446901 6:63753659-63753681 CCCAACATCTAGAGGGAGGGAGG - Intronic
1009929514 6:70160373-70160395 CCCCACATGTAGAGGGAGGGAGG - Intronic
1012774087 6:103480556-103480578 CCTAACATCCAGGGAGAGAGAGG + Intergenic
1012774249 6:103481633-103481655 CCTAATATCCAGAGCGGGGGTGG - Intergenic
1016330145 6:142946102-142946124 CCTTAAGGACAGAGGGAGGGCGG + Intergenic
1016566772 6:145464102-145464124 CCCAACATATCAAGGGAGGGAGG + Intergenic
1017396986 6:154012860-154012882 CATGACATACACAGGGAGAGAGG + Intronic
1017618045 6:156265879-156265901 GTTAACATGCAGATGGAGGGAGG + Intergenic
1018949377 6:168369232-168369254 CAGTACATACAGAAGGAGGGAGG - Intergenic
1020167122 7:5816379-5816401 GCCAACAGAGAGAGGGAGGGAGG - Intergenic
1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG + Intergenic
1020306696 7:6841186-6841208 CCTAATATCCACAGGGAGAGAGG + Intergenic
1020311153 7:6869814-6869836 CCTAATATCCACAGGGAGAGAGG + Intergenic
1020335144 7:7057245-7057267 CCTAACATCCGGTGGGGGGGGGG + Intergenic
1020804324 7:12769741-12769763 CCTCACTTACACAGGCAGGGAGG + Intergenic
1021435682 7:20612458-20612480 CCCAACATATCGAGGGAGGGAGG - Intergenic
1023113122 7:36834267-36834289 AGTCACACACAGAGGGAGGGTGG + Intergenic
1023878538 7:44306033-44306055 CCAAATACCCAGAGGGAGGGGGG + Intronic
1026633531 7:72060132-72060154 TCTAACATTCAGAGAGAGTGGGG + Intronic
1027999444 7:85473344-85473366 ACAAAGATACAGAGAGAGGGAGG + Intergenic
1028264335 7:88704782-88704804 ATCAACATACAGCGGGAGGGGGG - Intergenic
1029077849 7:97950133-97950155 CCTAATATCCACAGGGAGAGAGG + Intergenic
1029187246 7:98748106-98748128 GCAAAAATACAGAGAGAGGGAGG + Intergenic
1029301319 7:99584117-99584139 CCTAATATCCAGAGAGAGAGAGG - Intronic
1029301653 7:99586275-99586297 TCTAATATCCAGAGGGAGAGAGG - Intronic
1033604317 7:142914816-142914838 CTTCACAGACAGAGGGATGGAGG - Intronic
1034401170 7:150862587-150862609 CCTCAGCTCCAGAGGGAGGGAGG - Intergenic
1035314727 7:157990773-157990795 CCTCCGATACAGTGGGAGGGAGG + Intronic
1035787580 8:2274203-2274225 CCCCACATGCCGAGGGAGGGAGG + Intergenic
1035805230 8:2447513-2447535 CCCCACATGCCGAGGGAGGGAGG - Intergenic
1036078837 8:5530203-5530225 CATAACATACAGTGAGAGTGAGG - Intergenic
1036240146 8:7074373-7074395 CCTAATCTCCAGAGGGAGAGAGG - Intergenic
1036240159 8:7074448-7074470 CCTCACATCCAGAGGGAGAGAGG - Intergenic
1036819856 8:11931835-11931857 CCTAATATCCACAGGGAGAGAGG + Intergenic
1036819867 8:11931910-11931932 CCTAACATCCAGAGCGAAAGAGG + Intergenic
1036833042 8:12036861-12036883 CCTAACATCCAGAGCGAAAGAGG + Intergenic
1036903184 8:12687207-12687229 CCTAATATCCACAGGGAGAGAGG + Intergenic
1036903193 8:12687282-12687304 CCTAACATCCAGAGCGAAAGAGG + Intergenic
1036905667 8:12706796-12706818 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1039919670 8:41884411-41884433 GCTAACATACAGTGGCAGAGTGG + Intronic
1040681052 8:49809746-49809768 CCTCACATGTTGAGGGAGGGAGG + Intergenic
1040721334 8:50328645-50328667 CCCCACATGCTGAGGGAGGGAGG - Intronic
1041124528 8:54621686-54621708 ACTCACATACACAGGCAGGGAGG - Intronic
1042822056 8:72940410-72940432 CCTAACAGACATAGGAAAGGTGG - Intergenic
1043635391 8:82377004-82377026 CCTAACATCCAGAGGGGGAGAGG + Intergenic
1043635594 8:82378132-82378154 CGTAACATCCAGAGGGTGAGGGG + Intergenic
1044040678 8:87364642-87364664 CCTATCAGAGAGGGGGAGGGTGG - Intronic
1044119318 8:88375251-88375273 CCAAACATGCAAAGAGAGGGTGG + Intergenic
1045926235 8:107580975-107580997 CCTAATATACAGAGGGAGAGAGG + Intergenic
1046803278 8:118452086-118452108 TCCACCACACAGAGGGAGGGTGG + Intronic
1047180748 8:122585338-122585360 TCTAACATACAGCTGGAGAGTGG - Intergenic
1047875961 8:129137894-129137916 CCCGACATGTAGAGGGAGGGAGG + Intergenic
1048054990 8:130854847-130854869 AGTGACCTACAGAGGGAGGGAGG - Intronic
1048190425 8:132283035-132283057 CCGAACATACAGAGGGAATGAGG + Intronic
1048286629 8:133146819-133146841 CCAAACATCCAGAAGGAGTGAGG + Intergenic
1048290571 8:133178364-133178386 CCCAACATACATTGGGAGGAGGG + Intergenic
1048364971 8:133730580-133730602 CGTAACAAACATGGGGAGGGAGG - Intergenic
1048522147 8:135166388-135166410 CCCAAGAGAGAGAGGGAGGGTGG - Intergenic
1049216588 8:141411114-141411136 CCTGGCATACAGGAGGAGGGTGG - Intronic
1050902494 9:10965027-10965049 CCTAATATGCAGTGGGAGAGAGG - Intergenic
1051959937 9:22747226-22747248 CTAAACATTTAGAGGGAGGGAGG - Intergenic
1053738059 9:41114068-41114090 CCTAATATTCAGAGGCAGAGAGG - Intergenic
1054690288 9:68317251-68317273 CCTAATATTCAGAGGCAGAGAGG + Intergenic
1056604486 9:88075567-88075589 GATAAGATACAGAGGCAGGGGGG - Intergenic
1056674818 9:88666281-88666303 CCAACCAGACAGATGGAGGGTGG - Intergenic
1056865272 9:90222983-90223005 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1056866173 9:90228866-90228888 CCTAATATCCACAGGGAGAGAGG - Intergenic
1056866187 9:90228941-90228963 CCTAATATCCAGAGGGAGAGAGG - Intergenic
1056916840 9:90753968-90753990 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1056925540 9:90831141-90831163 CCTATCATACAGAGACAGTGGGG - Intronic
1058518112 9:105795554-105795576 CCTAACATACAGGGGAGGAGAGG - Intergenic
1058519934 9:105807191-105807213 CCTAATATAGAGAGGGTGAGAGG - Intergenic
1058520106 9:105808265-105808287 CCTAATATCCAGGGGGAGAGAGG - Intergenic
1058521083 9:105814752-105814774 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1058521236 9:105815772-105815794 CCTAATATGCAGGGGGAGAGAGG - Intergenic
1058522037 9:105821077-105821099 CCTAATATGCAGGGGGAGAGAGG - Intergenic
1060142596 9:121223291-121223313 CCTAACATTCCGAGTGAGAGGGG + Intronic
1060218428 9:121752100-121752122 CCTAACCTTGAGAGGGATGGGGG + Intronic
1061604432 9:131698237-131698259 CCTAACAAGCAAAGGGAGGAGGG + Intronic
1061721806 9:132556592-132556614 CCCATCACACAGAGGGAGAGGGG + Intronic
1203742081 Un_GL000218v1:11871-11893 CCTAACATCCATAGGGGGAGAGG - Intergenic
1189351833 X:40281328-40281350 GCTGCCAGACAGAGGGAGGGAGG - Intergenic
1191204151 X:57816678-57816700 CCCTCCATAGAGAGGGAGGGGGG + Intergenic
1194023155 X:88719285-88719307 CCTACCATACAGAGGAAATGTGG + Intergenic
1197453842 X:126652313-126652335 TCAAACATACAGAGAAAGGGTGG + Intergenic
1200247891 X:154535554-154535576 CTGCACATCCAGAGGGAGGGAGG + Intronic