ID: 1169178727

View in Genome Browser
Species Human (GRCh38)
Location 20:3543028-3543050
Sequence AACCAGTGAAAGCCTGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169178725_1169178727 9 Left 1169178725 20:3542996-3543018 CCTTCTGCATTTCAAGGGATTCT 0: 1
1: 0
2: 1
3: 29
4: 360
Right 1169178727 20:3543028-3543050 AACCAGTGAAAGCCTGATGATGG 0: 1
1: 0
2: 0
3: 19
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169178727 Original CRISPR AACCAGTGAAAGCCTGATGA TGG Intronic
900681634 1:3919956-3919978 AGCCAGTGAATACCTGAGGACGG - Intergenic
902179014 1:14673449-14673471 AACAAGTGACTGCCTGAAGAAGG + Intronic
904449887 1:30604319-30604341 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
907786107 1:57614468-57614490 AAACAGTGAAAGCTTCATCATGG - Intronic
909400031 1:75217707-75217729 AACCAGAGAGAGCTTGCTGAAGG - Intronic
914999871 1:152579542-152579564 AGCCTGTGAAAGCCAGAAGAGGG + Exonic
915219402 1:154362294-154362316 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
917215056 1:172669548-172669570 AACCAGAGAAATTCTGGTGATGG - Intergenic
917815117 1:178701318-178701340 CACCAGTGAAAGCCAGAAGGTGG - Intergenic
918653322 1:186993243-186993265 AACCAGTGACTAACTGATGAGGG + Intergenic
920103037 1:203529757-203529779 GAGCAGTGAACTCCTGATGAGGG - Intergenic
921840813 1:219826451-219826473 AAAGAAAGAAAGCCTGATGAGGG - Intronic
922507280 1:226133857-226133879 AACTAGTGAGAGCCTGGGGAGGG + Intergenic
1064781029 10:18838219-18838241 AGCCAGTGAAACCATGATCATGG - Intergenic
1068960614 10:62863170-62863192 GACTAATGAAGGCCTGATGAGGG - Intronic
1069981319 10:72254937-72254959 AGCCAGTGAAAGCCTGCAGAAGG - Intergenic
1070276594 10:75013090-75013112 ACCCAGTGAAACCCTGAGCATGG - Intronic
1070354757 10:75628997-75629019 AAGCAGTGAAGCCCTGAAGAAGG - Intronic
1070524258 10:77281642-77281664 AACCGGTGACTGCCTTATGATGG + Intronic
1071507672 10:86242496-86242518 GGCCTGTGAATGCCTGATGAGGG - Intronic
1072192180 10:93084915-93084937 AACCAGTGAAAAACTCATTATGG - Intergenic
1072450425 10:95535138-95535160 AATCAGGGAAAGCTTCATGAGGG + Intronic
1073851682 10:107627405-107627427 AAACCGTAAAAGGCTGATGATGG + Intergenic
1074021276 10:109586634-109586656 AAACGGGGAAAGCCTGGTGAGGG + Intergenic
1075309037 10:121396312-121396334 AAACAGTGTAAGCCAGAAGACGG + Intergenic
1076977855 11:189154-189176 ATTCAGTGGAAGGCTGATGAAGG + Intronic
1078655800 11:13238024-13238046 ACCCAGTGAAAGCCAGAGAACGG + Intergenic
1079698693 11:23517530-23517552 ACCCAGTGACAGCATGATGCAGG - Intergenic
1081529767 11:43950085-43950107 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
1090456641 11:126855847-126855869 GTCCAGAGAAACCCTGATGAAGG - Intronic
1095828940 12:46562107-46562129 ATTCAGTGAAAGGCTGATGAAGG + Intergenic
1096397758 12:51279377-51279399 AACCAGGGAAACAATGATGAGGG - Intergenic
1096904178 12:54917667-54917689 AAACTGTGAAACACTGATGAAGG + Intergenic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1097359618 12:58644632-58644654 AAACAGTATATGCCTGATGAGGG + Intronic
1102765009 12:115424902-115424924 ACTCAGTAAAAGCCTGCTGAAGG + Intergenic
1104148266 12:126056154-126056176 AACCAGTGAGAGCTTCATAAAGG + Intergenic
1108263417 13:48680431-48680453 GACCAGTTAAAGTCTGATGAGGG - Intronic
1108607238 13:52052013-52052035 ATTCAGTGAAAGGCTGATCAAGG + Intronic
1110965154 13:81685490-81685512 ATTCAGTGAAAGGCTGATCAAGG - Intergenic
1112988958 13:105487106-105487128 AACCCGTGAAAGCCAGCAGAGGG + Intronic
1115183560 14:30657372-30657394 AAACAGTGAAAACCTCATCAAGG - Intronic
1117237352 14:53792418-53792440 AAATAGTGAAAGCCTGAGGGAGG + Intergenic
1118577407 14:67257169-67257191 ATTCAGTGAAAGACTGATCAAGG - Intronic
1119774096 14:77237851-77237873 AACCTTTGAAAGGCTGAGGACGG - Intronic
1120006531 14:79364121-79364143 AACAAATGAAAGACTGTTGAAGG - Intronic
1124656522 15:31513598-31513620 AAACAGAGAAACCCTTATGAAGG - Intronic
1125588969 15:40843200-40843222 AACAGGTGAAAGACAGATGAAGG - Intergenic
1127102137 15:55577218-55577240 ATTCAGTGAAAGGCTGATCAAGG + Intronic
1132189905 15:99844724-99844746 AGACAGTGAAAATCTGATGAGGG + Intergenic
1134369558 16:13610393-13610415 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
1134660546 16:15981154-15981176 AACCCGTGAAAGCCCCTTGATGG - Intronic
1135573074 16:23564139-23564161 AACCAGTGAACGTCAGATGATGG - Intronic
1135863624 16:26080366-26080388 ACCTGGTGAAAGCCTGAGGACGG + Intronic
1137466879 16:48717909-48717931 AACCAGTAAAAGCCTGGTGGGGG + Intergenic
1138444897 16:57057650-57057672 AACCCTTGAAAGCCTGCTGGAGG + Intronic
1141606940 16:85159105-85159127 AACCAGAGAAAGTCTGATTGTGG - Intergenic
1142442477 16:90108179-90108201 ATTCAGTGGAAGGCTGATGAAGG - Intergenic
1142465276 17:133619-133641 ATTCAGTGGAAGGCTGATGAAGG + Intergenic
1143947888 17:10610115-10610137 AACTGGTGAAAGCCAGATAAAGG - Intergenic
1143990398 17:10954735-10954757 AACCATTGTAAGTGTGATGAAGG - Intergenic
1145880310 17:28348118-28348140 TACCAGTGAAGGCCTGAGGGTGG + Exonic
1149299812 17:55294701-55294723 AAGCAGTGAAGTCCTGAAGAAGG - Intronic
1150586638 17:66524352-66524374 AACAAATGAAAGCATAATGAAGG - Intronic
1154214294 18:12404514-12404536 AACCAGTGAAAGGCTGGGCATGG + Intergenic
1155078050 18:22380348-22380370 AAGCAGTGCAATCCAGATGAAGG + Intergenic
1158813331 18:61063633-61063655 CACCAGGGGAAGCCTGATGACGG - Intergenic
1160094826 18:75861831-75861853 CACCAGTCAAAGACTTATGAAGG - Intergenic
1162832189 19:13292260-13292282 AGCCACTGAAAGACAGATGAAGG + Intronic
1163590609 19:18192076-18192098 AACCAGTGAAAACCTCTAGAGGG + Intergenic
1167499838 19:49839370-49839392 AACAAGTCAACTCCTGATGATGG - Intergenic
925950358 2:8903747-8903769 AACCAAGGAAACCCGGATGAAGG - Intronic
928591931 2:32826111-32826133 AACCTGAGAAATCCTAATGATGG - Intergenic
930082614 2:47465724-47465746 ATTCAGTGAAAGGCTGATCAAGG - Intronic
930459826 2:51659150-51659172 ATCCAGTGAAATCCTGATAATGG + Intergenic
931513814 2:63029402-63029424 AACCAGGGATAGCTAGATGAAGG - Intronic
932834257 2:75020631-75020653 AATCAGTGGAAGGCTGCTGAGGG - Intergenic
933495500 2:83045870-83045892 AACAATTGTAAGCTTGATGAAGG - Intergenic
934045029 2:88166123-88166145 CACCAGAGAAAGCCTGATTCAGG - Intergenic
934910800 2:98252434-98252456 GGCCTGTGAAAGCCTGATGCAGG + Intronic
936527048 2:113248507-113248529 AACCAGTTAAAGACTGTTTATGG + Intronic
936901024 2:117481998-117482020 ATACATTGAAAGCCAGATGATGG - Intergenic
936986320 2:118314248-118314270 AACCAGTGAAGGAAGGATGAAGG + Intergenic
940103081 2:150064354-150064376 AGACAGGGAAAGCCTGATGCAGG + Intergenic
940616890 2:156059921-156059943 ATGCAGTGAAAGCCTAATAATGG - Intergenic
941035975 2:160569718-160569740 AACCAGGGAAAGCCTTTTCAGGG - Intergenic
943534435 2:189129832-189129854 AACAAGTGTAAGCCACATGAGGG - Intronic
945113064 2:206382627-206382649 AACCATTGAAATCATGATAAAGG + Intergenic
947053759 2:226076669-226076691 ATTCAGTCAAAGCATGATGAAGG - Intergenic
947247064 2:228060744-228060766 AGCCACAGAGAGCCTGATGAGGG + Intronic
1169178727 20:3543028-3543050 AACCAGTGAAAGCCTGATGATGG + Intronic
1179402082 21:41093793-41093815 AACCAGTGTCACCCTGCTGATGG + Intergenic
1181823889 22:25497600-25497622 AACCAGTGAATGCTAGTTGAAGG + Intergenic
1182034194 22:27184743-27184765 AACCAGTGAAATCCTCATCCAGG + Intergenic
1182501934 22:30754360-30754382 CACCAATCAAAGCCTGCTGAGGG - Intronic
1182760535 22:32719078-32719100 AACCAGGAAAAGCCTGAGGAAGG - Intronic
1185066300 22:48633220-48633242 AACCAGTGAAGGGATGAGGAGGG + Intronic
950625820 3:14246166-14246188 GACCAGTGAAAGACAGATGATGG - Intergenic
951822230 3:26826096-26826118 AACCAGTGAAATATGGATGAAGG - Intergenic
951955711 3:28251000-28251022 AACCAGAGACAGTCTGGTGAAGG + Intronic
954934483 3:54313807-54313829 CATCAGGGAAAGTCTGATGAGGG - Intronic
960742142 3:120846163-120846185 AAGCAGTCAAAGCATGATGCAGG + Intergenic
961710452 3:128824220-128824242 AACCAGAGAAGGCCTGAGAAGGG + Intergenic
964709809 3:159659736-159659758 AACCTGAGAAAGCTAGATGAAGG + Intronic
966150145 3:176858997-176859019 AGCCAATGAAAGCCTGATGGGGG + Intergenic
967242323 3:187452379-187452401 AACCAATGAAAGCCTCTAGAGGG - Intergenic
967360222 3:188622146-188622168 AACCAGTAAAAGGCAGATAATGG + Intronic
968259953 3:197313213-197313235 ACCCACTGATAGCCTTATGAGGG + Intergenic
968362750 3:198159139-198159161 ATTCAGTGGAAGGCTGATGAAGG - Intergenic
972355123 4:38273471-38273493 AGCCAGTGCCAGCCTGCTGAAGG - Intergenic
972834966 4:42859158-42859180 AACAACTGAAAGTCTGTTGATGG - Intergenic
978598673 4:110405577-110405599 ATTCAGTGAAAGGCTGATCAAGG + Intronic
978955962 4:114613925-114613947 ATCCAATTAATGCCTGATGATGG - Intronic
981181146 4:141746679-141746701 AAGCAATGATAGCCTAATGATGG + Intergenic
982326348 4:154132993-154133015 AAACACTGAAAGCCTGATTGCGG + Intergenic
984186169 4:176546273-176546295 AACCAGTGGCATCCTGGTGAGGG - Intergenic
984377096 4:178945666-178945688 AGCCAGGGAAAGGGTGATGAGGG - Intergenic
985098881 4:186437647-186437669 AAACAGTAAAACACTGATGAAGG + Intronic
987625834 5:20399080-20399102 AACCATGGAAAGTCTGATCACGG + Intronic
990295347 5:54396273-54396295 ATCCTGGGAAAGCCAGATGAAGG + Intergenic
991708544 5:69383803-69383825 AAGCAGTAAAAGCCAGATGCAGG - Intronic
995482165 5:112604210-112604232 AAGCAATGAAAGCCTGAGGCAGG - Intergenic
996754535 5:126921915-126921937 AATAAATGAAAGCCTGATTAGGG + Intronic
997527938 5:134565493-134565515 ATCAAGAGAAAGGCTGATGATGG - Intronic
999222422 5:149991520-149991542 AGCCACAGAAAGCCTGACGAGGG + Intronic
999791374 5:154942650-154942672 AACCAGTGAAAACTTCCTGAAGG - Intronic
999949798 5:156636563-156636585 AACCAGGGAAGGCTTCATGATGG + Intronic
1001744648 5:174082992-174083014 AAGCAGAGGAAGCCTGAGGAAGG - Intronic
1002154222 5:177262962-177262984 ATTCAGTGAAAGGCTGATGAAGG + Intronic
1006403131 6:33829451-33829473 GCCCAGTGAAAGCCTGATGCAGG + Intergenic
1011541147 6:88431536-88431558 AACCAGTGAAAAACTGAATAAGG + Intergenic
1012946812 6:105475060-105475082 CATCAGTGGAAGCCAGATGATGG - Intergenic
1015236125 6:130973321-130973343 AACCAATGAAAACTTTATGATGG - Intronic
1017577230 6:155818456-155818478 AACCAGAGAAAGCAAGAGGAAGG + Intergenic
1019252933 7:29572-29594 ATTCAGTGGAAGGCTGATGAAGG + Intergenic
1023217934 7:37885412-37885434 ACCCAGTGACAGCCTGAGGATGG + Intronic
1026291615 7:69011538-69011560 ATTCAGTGAAAGGCTGATCAAGG - Intergenic
1029794411 7:102878926-102878948 AATCAGAGAAAACCTGATGCTGG + Intronic
1030311107 7:108070333-108070355 AACTAGGGAAAGACTGAAGAGGG - Intronic
1031042642 7:116854868-116854890 AACCAATGACTGCCAGATGATGG - Intronic
1031561748 7:123247404-123247426 ACCCAGAGAAAGGCTGCTGATGG - Intergenic
1031877178 7:127154983-127155005 CACCCCTGAAAGCCTGAAGAAGG + Intronic
1032801308 7:135319288-135319310 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
1032866406 7:135929713-135929735 TCCCAGTAAAAGCCTGATCATGG + Exonic
1033318470 7:140317877-140317899 AACTAATAAAGGCCTGATGAGGG + Intronic
1033870788 7:145751553-145751575 AGCCAGTGAGAGGCTGATGCTGG + Intergenic
1034626861 7:152500204-152500226 ATTCAGTGAAAGGCTGATCAAGG + Intergenic
1034914184 7:155023260-155023282 AGGCAGTGAGAGCCTGATGAGGG + Intergenic
1036146149 8:6256686-6256708 ATTCACTGAAAGACTGATGAGGG - Intergenic
1036743987 8:11391081-11391103 AAGCAGGGAAAGCCTGGTGATGG + Intronic
1037434154 8:18845428-18845450 GACGAGTGAAGGACTGATGAGGG - Intronic
1037474387 8:19242145-19242167 CCCCAGTGAAAGTCTTATGATGG - Intergenic
1037893979 8:22639776-22639798 AGCCAGGGAAACCCTGATGTTGG + Intronic
1037931323 8:22882045-22882067 AACCAGTGACAGCCACATGTTGG - Intronic
1040897006 8:52378959-52378981 GACAATTGAAAGCATGATGAGGG - Intronic
1042358422 8:67854912-67854934 AACTAGTCAAAGCCGGAAGAAGG - Intergenic
1043052297 8:75398893-75398915 AACCAGCTAAAGCCGGATTATGG + Intergenic
1044052104 8:87517848-87517870 AAACAGTGAAAACATGTTGATGG - Intronic
1045359154 8:101415829-101415851 CACCTGTGAGAGACTGATGAAGG + Intergenic
1045984463 8:108233593-108233615 AAGCATTGAAAGGCTGAGGAGGG + Intronic
1047206012 8:122803332-122803354 CACCAGTGAAAGCCTGCAGGAGG - Intronic
1051734415 9:20183872-20183894 CACCAGTGAAATTCTGATGCAGG - Intergenic
1053058842 9:35012580-35012602 ATTCAGTGAAAGGCTGATCAAGG - Intergenic
1053060581 9:35027939-35027961 ATTCAGTGAAAGGCTGATCAAGG - Intergenic
1053144261 9:35701676-35701698 ATCCAGTTAAGGACTGATGATGG + Intronic
1058226349 9:102369275-102369297 ACCAAGTTACAGCCTGATGAGGG - Intergenic
1059029683 9:110677604-110677626 TACCCGTGAAAGCCTGAAGACGG - Intronic
1059589910 9:115647639-115647661 AACCAGTGAAGGGCTCATGAAGG - Intergenic
1060401685 9:123353344-123353366 AACCAGTGAGACCCTGAGAAGGG + Intergenic
1060829482 9:126704665-126704687 AACGAGTGGCAGGCTGATGATGG + Intergenic
1061376405 9:130227385-130227407 AACCAGTGGATGCCTGCTGTTGG + Intronic
1062374090 9:136254262-136254284 GACCAGCGAGAGCCTGATGGGGG - Intergenic
1062747437 9:138222802-138222824 ATTCAGTGGAAGGCTGATGAAGG - Intergenic
1185917199 X:4048509-4048531 ATTCAGTGAAAGGCTGATCAAGG - Intergenic
1188705414 X:33322564-33322586 AACCAGTGTCAGCTTGTTGAGGG + Intronic
1189067488 X:37825880-37825902 AACAAGTGAAAGCCTGAAGTGGG - Intronic
1189192499 X:39122643-39122665 ACCCAGAGAAAGCCTGAGAAGGG + Intergenic
1190120144 X:47652274-47652296 AATCAGTGAAAACCAGATGGTGG - Intronic
1193213813 X:78839357-78839379 ATTCAGTGGAAGGCTGATGAAGG + Intergenic
1193639869 X:84000055-84000077 ACTCAGTGAAAGGCTGATCAAGG - Intergenic
1195398495 X:104436632-104436654 AATCAGTGAATGCCTGCTGGTGG + Intergenic
1195737745 X:108031184-108031206 AATCAGGGAAGGCCTCATGAAGG + Intergenic
1195941360 X:110170445-110170467 AATCAGTGAAAGACTGATTTGGG + Intronic
1195941760 X:110173189-110173211 AGCCAGAGAAAGCCTAAGGATGG + Intronic
1198987485 X:142472398-142472420 AACCAGATAAAGCATGATAAGGG + Intergenic
1199174945 X:144776458-144776480 AAGCAGTGGAAGGCTGATCAAGG - Intergenic
1199746831 X:150777026-150777048 ATTCAGTGAAAGGCTGATCAAGG - Intronic
1201109347 Y:10787646-10787668 AAACAGTGATATCCTGATGAAGG - Intergenic