ID: 1169180163

View in Genome Browser
Species Human (GRCh38)
Location 20:3557488-3557510
Sequence CTCAAACAAGAGTGAATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 870
Summary {0: 1, 1: 0, 2: 15, 3: 156, 4: 698}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169180158_1169180163 21 Left 1169180158 20:3557444-3557466 CCAGCCAAGGTGTCATTCTGCTG 0: 1
1: 0
2: 3
3: 16
4: 169
Right 1169180163 20:3557488-3557510 CTCAAACAAGAGTGAATTCAGGG 0: 1
1: 0
2: 15
3: 156
4: 698
1169180159_1169180163 17 Left 1169180159 20:3557448-3557470 CCAAGGTGTCATTCTGCTGTAAA 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1169180163 20:3557488-3557510 CTCAAACAAGAGTGAATTCAGGG 0: 1
1: 0
2: 15
3: 156
4: 698
1169180157_1169180163 22 Left 1169180157 20:3557443-3557465 CCCAGCCAAGGTGTCATTCTGCT 0: 1
1: 0
2: 1
3: 17
4: 168
Right 1169180163 20:3557488-3557510 CTCAAACAAGAGTGAATTCAGGG 0: 1
1: 0
2: 15
3: 156
4: 698

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169180163 Original CRISPR CTCAAACAAGAGTGAATTCA GGG Intronic
900768037 1:4518632-4518654 CTCAGAGAAGAGTGACATCAGGG - Intergenic
901495671 1:9620173-9620195 CTCACACAAGAAAGAATTCAGGG - Intergenic
901620248 1:10579490-10579512 CTCACACAAGAAAGAATTCTGGG + Intronic
901742164 1:11349289-11349311 CTCAAACAAGAGTGGGTCGAGGG + Intergenic
903150214 1:21402375-21402397 CTCACACAAGAAAGAATTCAGGG - Intergenic
903877211 1:26483344-26483366 CTCGAGCAAGAAAGAATTCAAGG + Intergenic
904557944 1:31377420-31377442 CTCACACAAGAAAGAATTCGGGG + Intergenic
906260489 1:44384698-44384720 CTCAAACAAGTGAGAATGTAGGG - Intergenic
906500644 1:46339883-46339905 CTCGCACAAGAAAGAATTCAGGG + Intergenic
906989816 1:50725817-50725839 TTCAAGCAGGAGTAAATTCAGGG - Intronic
907169631 1:52450411-52450433 ATCAAACAAGAGACAGTTCATGG - Intronic
907414974 1:54307992-54308014 CTCGCACAAGAAAGAATTCAGGG - Intronic
907979018 1:59462290-59462312 CTTATACAAAAGTTAATTCAAGG + Intronic
908582467 1:65530369-65530391 CTCATGCAAGAAAGAATTCAGGG + Intronic
908752843 1:67441322-67441344 CTCAAACAAAAAGGAACTCAAGG - Intergenic
910090103 1:83451929-83451951 CTAAAACACTTGTGAATTCAGGG - Intergenic
910721649 1:90293356-90293378 TTCAAACAGGGGTTAATTCAAGG + Intergenic
911153054 1:94613462-94613484 CTCACGCAAGAAAGAATTCAGGG - Intergenic
911189276 1:94931877-94931899 TTCACACAAGAAAGAATTCAGGG - Intergenic
911572549 1:99535435-99535457 CTCACACAAGAAAGATTTCAAGG + Intergenic
911624461 1:100105109-100105131 CTTGAAGAAGAGAGAATTCAGGG - Intronic
911765592 1:101670746-101670768 CTCATGCAAGAAGGAATTCAGGG - Intergenic
911951393 1:104177658-104177680 CTCGCACAAGAAAGAATTCAGGG - Intergenic
911953243 1:104203991-104204013 CTCACACAAGAAATAATTCAGGG + Intergenic
912071556 1:105816835-105816857 CTTAAACAAAAATTAATTCAAGG - Intergenic
912388733 1:109286650-109286672 CTCACACGAGAAAGAATTCAAGG + Intergenic
913484985 1:119326186-119326208 CTCACACAAGAAAGAATTCTGGG - Intergenic
914442578 1:147720373-147720395 CTCACACAAGAAAGAATTCAGGG - Intergenic
915211740 1:154314585-154314607 CTCATGCAAGAAAGAATTCAGGG - Intergenic
915236382 1:154486254-154486276 ATCATACAAGAGTGAGTTAACGG + Intronic
915995851 1:160562553-160562575 CTTAAACAAAAATTAATTCAAGG + Intronic
916259960 1:162831868-162831890 CTCTCACAAGAAAGAATTCAGGG - Intronic
916810749 1:168303541-168303563 CTCATGCAAGAAAGAATTCAGGG + Intronic
917071796 1:171159589-171159611 CTCTCACAAGAAAGAATTCAGGG - Intronic
917177682 1:172255435-172255457 GTCAAACAAAATTGAATCCATGG + Intronic
917379176 1:174384726-174384748 CTAAAACAACAGTGACTTTAAGG - Intronic
917566851 1:176221231-176221253 CTCACGCAAGAAGGAATTCAGGG - Intergenic
917708102 1:177655164-177655186 CTCATGCAAGAAAGAATTCAGGG - Intergenic
917911125 1:179647433-179647455 CTTAAACAAAAATCAATTCAAGG + Intronic
918171180 1:181998889-181998911 CTTAAACAAGAGTGTGGTCACGG + Intergenic
918347789 1:183621511-183621533 CTCACACAAGAAAGAATTCAAGG + Intergenic
918589800 1:186228207-186228229 CTCACATAAGAAAGAATTCAGGG - Intergenic
918637614 1:186797093-186797115 CTTAAGCAAGAGTGATTTGAAGG - Intergenic
918796509 1:188904665-188904687 CTCAAGCAAAAGTGATTTCTGGG + Intergenic
918840955 1:189538870-189538892 CTCGCACAAGAAAGAATTCAGGG - Intergenic
919351294 1:196457542-196457564 GTCACACCAGAGTGACTTCAGGG - Intronic
919827435 1:201513284-201513306 CTCACGCAAGAAGGAATTCAGGG + Intergenic
919966478 1:202531903-202531925 CTCACGCAAGAAAGAATTCAGGG + Intronic
919969055 1:202560298-202560320 CTCACGCAAGAAAGAATTCAGGG + Intronic
920990153 1:210929683-210929705 ATCAGACAAGAGAGAAATCAAGG + Intronic
921077395 1:211711195-211711217 CTCGAGCAAGAAAGAATTCAGGG - Intergenic
921474140 1:215585109-215585131 CTCTCACAAGAAAGAATTCAGGG + Intronic
921535446 1:216344025-216344047 CTCACTCAAGAAAGAATTCAAGG - Intronic
922159733 1:223070337-223070359 CTCACACAAGAAAGAATTAAGGG - Intergenic
922190895 1:223317464-223317486 CTCATGCAAGAAAGAATTCAGGG - Intronic
922815965 1:228449676-228449698 CTCATACAAGAAAGAATTCAGGG - Intergenic
923386741 1:233472427-233472449 CTCATGCAAGAAGGAATTCAGGG - Intergenic
923616992 1:235546280-235546302 CTCATGCAAGAGAGAATTCAGGG + Intergenic
923702625 1:236314691-236314713 CTCGAGCAAGAAAGAATTCAGGG - Intergenic
924139941 1:241012011-241012033 CTCACATAAGAAAGAATTCAGGG - Intronic
924208680 1:241742740-241742762 CTCACACAAGAAAGAATTCAAGG - Intronic
924449125 1:244161961-244161983 CTCACGCAAGAAAGAATTCAGGG + Intergenic
924647031 1:245887482-245887504 CTCACACAAGAAAGAATTCAGGG - Intronic
1063109975 10:3027011-3027033 CTCAAAAAAGGGTAAAATCAGGG - Intergenic
1063751083 10:8948067-8948089 CTCACACAAAAAGGAATTCAGGG - Intergenic
1063880832 10:10530103-10530125 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1063882059 10:10541359-10541381 CTCATGCAAGAAAGAATTCAAGG + Intergenic
1064075461 10:12265102-12265124 CTCGCACAAGAAGGAATTCAGGG + Intergenic
1064098589 10:12443499-12443521 CTCACACAAGAAAGAATTCAGGG + Intronic
1064098890 10:12446147-12446169 CTCGTGCAAGAGAGAATTCAGGG + Intronic
1064536021 10:16358716-16358738 CTCAAGCAATAAAGAATTCAGGG - Intergenic
1064570272 10:16685340-16685362 CTCACACAAGAAAGAATTCAGGG + Intronic
1064888424 10:20139266-20139288 CTCAAATAATAGCGAATACACGG - Intronic
1064952811 10:20873007-20873029 CTCACACAAGAAAGAATTCAGGG - Intronic
1065057575 10:21862264-21862286 CTCACACAACAAAGAATTCAGGG - Intronic
1065173488 10:23054656-23054678 CTCAAGCAAGAAAGAATTCAGGG + Intergenic
1065290230 10:24222434-24222456 CTCGCACAAGAAAGAATTCAGGG + Intronic
1065384797 10:25124308-25124330 CTCACACAAGAAAGAATTCAGGG - Intergenic
1065505360 10:26425177-26425199 CTCACACAAAAAGGAATTCAAGG - Intergenic
1065516597 10:26530038-26530060 TTCATACAAGAGTGATTTCAAGG - Intronic
1065792662 10:29275657-29275679 CTCACGCAAGACAGAATTCAGGG + Intergenic
1066362026 10:34740300-34740322 CTGAGACAGCAGTGAATTCAAGG + Intronic
1067811788 10:49433814-49433836 CTCAAAAAAAAATGAATACATGG + Intergenic
1067903366 10:50264980-50265002 GTCAGACAAAAGTGAATTAAAGG + Intergenic
1068048370 10:51916570-51916592 ATCACACAAGAAAGAATTCAAGG - Intronic
1068977300 10:63023660-63023682 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1069010613 10:63367540-63367562 CTCAAACTAGGGTGAATTGCCGG - Intronic
1070251332 10:74776186-74776208 CTCATACAAGAAAGAATTCAGGG - Intergenic
1070690821 10:78523716-78523738 CTCAACCAAGAATAAATACAAGG + Intergenic
1071331666 10:84566599-84566621 CTCACACAAGAAAAAATTCAGGG - Intergenic
1071829311 10:89356093-89356115 CTCACACAAGAAAGAAATCAGGG - Intronic
1073489811 10:103845696-103845718 CTCCAGCAAGAAAGAATTCAGGG - Intronic
1073531507 10:104236787-104236809 CTCACGCAAGAACGAATTCAGGG - Intronic
1073679005 10:105681340-105681362 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1073990450 10:109256805-109256827 CTCACACAAGAAAGAATTCAGGG + Intergenic
1074876639 10:117618782-117618804 CTCACACAAGAAAGAATTCAGGG - Intergenic
1075118127 10:119644232-119644254 CTCAAACATAAGTGAATCAACGG - Intergenic
1075197054 10:120368915-120368937 CTCAAACTTGAGTGCATACAAGG - Intergenic
1075927994 10:126268897-126268919 CTTACACAAGAAAGAATTCAGGG + Intronic
1075977475 10:126708127-126708149 CTCACACAATAAAGAATTCAGGG + Intergenic
1077859322 11:6160792-6160814 CTCACACAAGAAAGAATTCAGGG + Intergenic
1078561848 11:12378879-12378901 CTCACGCAAGAAAGAATTCAGGG + Intronic
1079965573 11:26976109-26976131 CTCACACAAGAAAGAATTCAAGG + Intergenic
1079989812 11:27234556-27234578 CTCAAACAAGTGGGAATTCCTGG + Intergenic
1081351939 11:42064821-42064843 CTCGCACAAGAAAGAATTCAGGG - Intergenic
1082059091 11:47845488-47845510 CTCGCACAAGAAAGAATTCAGGG - Intronic
1082061130 11:47861119-47861141 CTCACACAAGAAAGACTTCAGGG - Intergenic
1082224357 11:49685472-49685494 CTCAAACATGTGTGATTTCTTGG + Intergenic
1082926433 11:58552151-58552173 GACAAGCAAGAGTGAATACAGGG + Intronic
1082941330 11:58708364-58708386 CTCAAACAAGAGTCAGTTGAGGG - Intronic
1083209606 11:61174915-61174937 GTCAGACAAGGGTGCATTCAAGG - Intergenic
1083691948 11:64414838-64414860 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1083700354 11:64473379-64473401 TTCACACAGGAGAGAATTCAAGG - Intergenic
1083709934 11:64541647-64541669 CTCACACAGGAAGGAATTCAAGG + Intergenic
1084314674 11:68338290-68338312 ACCAAACAAGACTCAATTCAAGG - Intronic
1084600098 11:70140175-70140197 CTCACACAAGAAAGAATTCAGGG + Intronic
1085069329 11:73528639-73528661 CTCACGCAAGAAAGAATTCAGGG - Intronic
1085145864 11:74196587-74196609 CTCACTCAAGAAAGAATTCAGGG + Intronic
1085182823 11:74550436-74550458 CTCAAGCAAGAAATAATTCAGGG - Intronic
1085963761 11:81496113-81496135 TTCACACAAGAAAGAATTCAGGG - Intergenic
1085970153 11:81579667-81579689 CTAAATCAAGAAAGAATTCATGG - Intergenic
1086081638 11:82909045-82909067 CTCGCACAAGAAAGAATTCAGGG + Intronic
1086232628 11:84588908-84588930 CTCAGGCAAGAAAGAATTCAGGG - Intronic
1086294100 11:85345978-85346000 CTCGTACAAGAAAGAATTCAGGG + Intronic
1086390345 11:86357063-86357085 CTCCCACAAGAAAGAATTCAAGG - Intergenic
1086541302 11:87915753-87915775 CTCACACAAGAAAGAATTCAAGG - Intergenic
1086624689 11:88933722-88933744 CTCAAACATGTGTGATTTCTTGG - Intronic
1086953032 11:92909961-92909983 CTCAGAGAAGAGTGCATCCAAGG + Intergenic
1087186869 11:95208902-95208924 CTTAAACAAAAATTAATTCAAGG + Intronic
1087797324 11:102468266-102468288 CTCACACAAGAAAGAATTCAAGG + Intronic
1087843019 11:102939610-102939632 CTCACGCAAGAAAGAATTCAGGG + Intergenic
1088253427 11:107881123-107881145 CTCACACAATAAAGAATTCAGGG + Intronic
1088317127 11:108519125-108519147 CTCGCACAAGAAAGAATTCAGGG - Intronic
1088485570 11:110337136-110337158 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1088681049 11:112242023-112242045 CTCACACAGGAAAGAATTCAGGG + Intronic
1088681901 11:112250737-112250759 CTCACACAGGAAGGAATTCAAGG - Intronic
1089385262 11:118063243-118063265 CTCACCCAAGAAAGAATTCAGGG - Intergenic
1089542967 11:119201700-119201722 CTCGCACAAGAAAGAATTCAGGG - Intergenic
1089628555 11:119769139-119769161 CTCCTACAAGATTGAATTCCAGG + Intergenic
1089820992 11:121226062-121226084 CTCAAACAAGAAAGAATTCAAGG + Intergenic
1090455316 11:126844056-126844078 CTCGTACAAGAAAGAATTCAGGG - Intronic
1090455874 11:126849454-126849476 CTCACATAAGAAAGAATTCAGGG - Intronic
1090572414 11:128061609-128061631 CTCAAAGAAGAGTGGATTGAAGG + Intergenic
1091069514 11:132550045-132550067 CTCATGCAAGAAAGAATTCAGGG - Intronic
1091204593 11:133811206-133811228 ATCTAAAAAGAGTGAATCCAAGG + Intergenic
1091240999 11:134052351-134052373 CTCACTCAAGAGAGAATTCGGGG + Intergenic
1093139300 12:15489267-15489289 CTCACGCAAGAAAGAATTCAGGG + Intronic
1093170413 12:15853563-15853585 CTCTAGCAAGAAAGAATTCAGGG + Intronic
1093732699 12:22583964-22583986 CTCACACAAGAGAGAATTCAGGG - Intergenic
1093735798 12:22618880-22618902 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1093871331 12:24295306-24295328 CTTAAACAAGAGGGTATTGAAGG - Intergenic
1093921253 12:24862231-24862253 CTCACACAAGAAAGAATTCAGGG - Intronic
1094116076 12:26914784-26914806 CTCAAACATAAATGCATTCATGG + Intronic
1094299241 12:28943028-28943050 CTCAAAAAATGGTGACTTCAGGG - Intergenic
1094699100 12:32851467-32851489 CTCAAACAAAAAAGAATTTAGGG - Intronic
1095043581 12:37472661-37472683 CTCACACAGGAAAGAATTCAAGG + Intergenic
1095405947 12:41867340-41867362 CTAAAGCAAGAGTCAATCCAAGG + Intergenic
1095478254 12:42608165-42608187 CTCACGCAAGAAAGAATTCAAGG - Intergenic
1096038260 12:48492028-48492050 ATTAAATAAGATTGAATTCAAGG + Intronic
1097409232 12:59229802-59229824 CTTAAACAGGAGTGTATTCTGGG + Intergenic
1097412614 12:59273721-59273743 CATAAAAAAGAGTGAGTTCATGG + Intergenic
1097964289 12:65562562-65562584 CTCAAGCAAGAGAGAATTCAGGG - Intergenic
1098439116 12:70499529-70499551 CTCATACAAGAAAGAATTCAGGG + Intergenic
1098921206 12:76303787-76303809 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1098955580 12:76686430-76686452 CTCACACAAGAAAGGATTCAGGG + Intergenic
1099325478 12:81209600-81209622 CTCACACAAGATTGAATTCAGGG + Intronic
1099700263 12:86074757-86074779 CTCAAAGAAGAGAGAATTGAAGG + Intronic
1099799828 12:87442945-87442967 CTCACACAAGAAAGAATTCAGGG + Intergenic
1100426549 12:94492759-94492781 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1100829844 12:98507890-98507912 CTCACACAAGAAAGAATTCAAGG + Intergenic
1101799322 12:108006874-108006896 CTCATGCAAGAGAGAATTCGAGG + Intergenic
1101814987 12:108139276-108139298 TTCAAACAAGAGAGAATTTATGG + Intronic
1102201137 12:111058729-111058751 CTCACGCAAGAAAGAATTCAGGG + Intronic
1102335266 12:112073435-112073457 CTCAAAAAAAAGTGAATAAATGG - Intronic
1102939285 12:116924894-116924916 GACAAACCAGAGTAAATTCAAGG - Intronic
1103133961 12:118491580-118491602 CTCACTCAAGAAAGAATTCAGGG + Intergenic
1103211534 12:119170625-119170647 CTCACACAAGAAAGAATTCCAGG + Intergenic
1103662874 12:122535822-122535844 CAAAAAAAAGAGTGAATTAAGGG + Intronic
1103769805 12:123312789-123312811 TTTAAACAACTGTGAATTCATGG + Intronic
1103868512 12:124073385-124073407 CTCATAAAAGAAAGAATTCAGGG + Intronic
1103962111 12:124615469-124615491 CTCACACAAGAAAGAATTCAGGG + Intergenic
1104128135 12:125866729-125866751 ATCAAGCAAGAAAGAATTCATGG + Intergenic
1104372844 12:128238497-128238519 CTCGCACAAGAAAGAATTCAGGG - Intergenic
1104448207 12:128849770-128849792 CTCACACAAGAAAGAATTCAGGG + Intergenic
1104507253 12:129344176-129344198 CTCACGCAAGAAAGAATTCAGGG - Intronic
1104770709 12:131362234-131362256 CTCACACAAGAAAGAATTCCAGG + Intergenic
1104808519 12:131605132-131605154 CTCATGCAAGAAAGAATTCAAGG + Intergenic
1105778209 13:23682250-23682272 CTCGAGCAAGAAAGAATTCAGGG - Intergenic
1105937591 13:25116639-25116661 CTCCCACAAGAAAGAATTCAGGG - Intergenic
1106331768 13:28745961-28745983 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1106591049 13:31098866-31098888 CTCACACAAGAAAGAATTCAAGG - Intergenic
1106732989 13:32561223-32561245 CTCACACAAGAAAGAATTCAGGG - Intergenic
1106823562 13:33492829-33492851 CTCGCACAAGAAAGAATTCAGGG - Intergenic
1106927611 13:34630014-34630036 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1107049181 13:36029115-36029137 CTCGCACAAGAATGAATTCGAGG - Intronic
1107376004 13:39805366-39805388 CTCACAAAAGAAAGAATTCAGGG + Intergenic
1107970968 13:45641843-45641865 CTCACACAAGAAAGAATTCAGGG - Intergenic
1108507770 13:51128282-51128304 CTCGCACAAGAGAGAATTCAGGG - Intergenic
1109442950 13:62398762-62398784 CTCACGCAAGAAAGAATTCAGGG - Intergenic
1109527667 13:63597898-63597920 CTCATGCAAGAAAGAATTCAAGG + Intergenic
1109704645 13:66073954-66073976 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1110058777 13:71014835-71014857 CTCATACAAGAAAAAATTCAGGG + Intergenic
1110261657 13:73491751-73491773 TTCAAGCAAGGGTGAATCCAGGG - Intergenic
1111438073 13:88238624-88238646 CTCCCACAAGAAAGAATTCATGG - Intergenic
1111492354 13:88997258-88997280 TTGAAACAAGTATGAATTCAAGG + Intergenic
1111757385 13:92415494-92415516 CTCAGTCAAGAGTGAATTCATGG - Intronic
1112192897 13:97195070-97195092 CTCACACAAGAAAGAATTCGAGG - Intergenic
1112715361 13:102178712-102178734 CACAAAAAAGAATGAAATCATGG - Intronic
1113161247 13:107383745-107383767 CTTAAACAAGAACAAATTCATGG + Intronic
1113523841 13:110958641-110958663 CTCACGCAAGAAAGAATTCAAGG - Intergenic
1114393089 14:22331241-22331263 CTCACGCAAGAAAGAATTCAGGG - Intergenic
1114430361 14:22655596-22655618 CTCACGCAAGAAAGAATTCAGGG - Intergenic
1114749614 14:25188383-25188405 CTTATACAAAAGTTAATTCAAGG + Intergenic
1114764583 14:25356448-25356470 CTCACACAAGAAAGAATTCAAGG - Intergenic
1115315880 14:32024471-32024493 CTCCCACAAGAAGGAATTCAGGG - Intergenic
1115382973 14:32760608-32760630 CTCAAAGAAGATTGAATACACGG - Intronic
1115481805 14:33868197-33868219 CTCATGCAAGAAAGAATTCAAGG - Intergenic
1115838197 14:37433854-37433876 CATAAAGAAGAGTGAGTTCAGGG - Intronic
1116065083 14:39972131-39972153 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1116191244 14:41670932-41670954 CTCAAAGAAAAGTCAGTTCAAGG - Intronic
1116329362 14:43576960-43576982 CTCGCACAAGAAAGAATTCAGGG - Intergenic
1116345692 14:43790527-43790549 CTCACACAAAAAAGAATTCAGGG + Intergenic
1116550570 14:46232150-46232172 CTTATACAAAAATGAATTCAAGG + Intergenic
1116897735 14:50333674-50333696 CTCATGCAAGAAAGAATTCAGGG - Exonic
1117327997 14:54686413-54686435 GTCATATAACAGTGAATTCAGGG + Intronic
1117969381 14:61237034-61237056 TTCACACAAGAAAGAATTCAGGG - Intronic
1118118674 14:62810868-62810890 CTCATGCAAGAAAGAATTCAGGG - Intronic
1118303973 14:64639146-64639168 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1118304583 14:64645181-64645203 CTCACACAAGAAAGAATTCAGGG - Intergenic
1118406851 14:65432977-65432999 TTCACACAAGAAAGAATTCAGGG - Intronic
1118481490 14:66171636-66171658 TTCAATCAAGAGTGAAATCTGGG - Intergenic
1119034667 14:71219426-71219448 CTCATACAAGAAAGAATTCAAGG + Intergenic
1119049333 14:71350656-71350678 CTCTTACAAGAGTGAAGTTAGGG + Intronic
1119102639 14:71894577-71894599 CTCACGCAAGAAAGAATTCAGGG - Intergenic
1119691956 14:76680170-76680192 CTCGCACAAGAAAGAATTCAGGG - Intergenic
1120044307 14:79789410-79789432 CTCACGCAAGAAAGAATTCAGGG + Intronic
1120408219 14:84116189-84116211 CTTATACAAAAGTTAATTCAAGG - Intergenic
1120436892 14:84493700-84493722 CTCACACAAGAAAGAATTCAGGG + Intergenic
1120865885 14:89294922-89294944 CTCAAACAAGAAAGAATTCAGGG - Intronic
1121149425 14:91617953-91617975 CTCACACAAGAAAGAATTCAGGG + Intronic
1121319801 14:92985576-92985598 CCCAAACAAGAGTGTCTTCAGGG - Intronic
1121388862 14:93556990-93557012 CTCATGCAGGAGGGAATTCAAGG + Intronic
1121400500 14:93672453-93672475 CTAAAAAAAGATTGATTTCATGG + Intronic
1121673489 14:95732253-95732275 CTCACGCAAGAAAGAATTCAGGG + Intergenic
1121794001 14:96720705-96720727 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1122551332 14:102551780-102551802 CTCACACAAGAAAGAATTCCAGG - Intergenic
1122592209 14:102861680-102861702 CTCATGCAAGAAAGAATTCAGGG + Intronic
1122681186 14:103464598-103464620 CTCATTCAAGAGTCAAATCATGG - Intronic
1122868618 14:104622871-104622893 CTCACACAAGAAAGAATTCAGGG - Intergenic
1122911157 14:104828135-104828157 CTCACGCAAGAAAGAATTCAGGG + Intergenic
1202942112 14_KI270725v1_random:160254-160276 CTCACACAGGAAAGAATTCAAGG + Intergenic
1124114500 15:26828573-26828595 CTCGCACAAGAAAGAATTCAGGG + Intronic
1124208782 15:27745096-27745118 CTCCCACAAGAAAGAATTCAGGG + Intergenic
1124438873 15:29672868-29672890 CTCACGCAAGAAAGAATTCAGGG + Intergenic
1124809956 15:32926020-32926042 ATAAAACAAGAGTGAGTTGATGG + Intronic
1125667510 15:41443522-41443544 TTCAAACAAGAGTGATTGGAAGG + Intronic
1126260379 15:46682502-46682524 CTCACACAAGAAAGAATTCAGGG - Intergenic
1126291308 15:47083186-47083208 CTCACACAGGAAAGAATTCAAGG - Intergenic
1126739266 15:51761220-51761242 CTGAAACAAGAGTGAAAAGAAGG + Intronic
1126942978 15:53786022-53786044 GTTAAACAAGAGTGAAAACAAGG + Intergenic
1127198077 15:56612131-56612153 CTCATTCAAGAAAGAATTCAGGG - Intergenic
1127212091 15:56783898-56783920 CTCACACAATAAAGAATTCAGGG - Intronic
1127344514 15:58080739-58080761 CTCACGCAAGAAAGAATTCAGGG + Intronic
1127949850 15:63794275-63794297 CTCACGCAAGAAAGAATTCAGGG - Intronic
1128148788 15:65348304-65348326 CTCACGCAAGAAAGAATTCAGGG - Intronic
1129261707 15:74372221-74372243 GTCCAACAAGAGTGAAATGAAGG + Intergenic
1129832081 15:78677287-78677309 CTAAAAAAAAAGTGAATTCAGGG + Intronic
1129922891 15:79335524-79335546 CTAAAACTAGAAGGAATTCAGGG + Intronic
1130381453 15:83375815-83375837 CTCAATCTTGAGTGAATCCAGGG + Intergenic
1130583292 15:85157870-85157892 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1132716647 16:1293471-1293493 CTCTCACAAGAAAGAATTCAGGG + Intergenic
1132988705 16:2781948-2781970 CTCACACAGGAAGGAATTCAAGG - Intergenic
1133493105 16:6290850-6290872 CTCAGGCAAGAAAGAATTCAGGG + Intronic
1133561759 16:6956952-6956974 TTCACACAAGAAAGAATTCAGGG + Intronic
1133655368 16:7857246-7857268 CTCAAGCAAGAAACAATTCAGGG + Intergenic
1133882435 16:9795534-9795556 CTCATGCAAGAAAGAATTCAGGG - Intronic
1133945256 16:10342634-10342656 CTCACGCAAGAAGGAATTCAGGG - Intronic
1134000159 16:10776631-10776653 CTCACCCAAGAAAGAATTCAGGG + Intronic
1134061142 16:11200420-11200442 CTCAAAGAAAAGCAAATTCAGGG + Intergenic
1134097449 16:11427989-11428011 CTCCCACAAGAAAGAATTCAGGG + Intronic
1134236940 16:12474014-12474036 CTCAAGCAAGAAAGAATTTACGG - Intronic
1134328731 16:13230652-13230674 CTCATGCAAGAAAGAATTCAGGG + Intronic
1134762184 16:16724158-16724180 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1134983876 16:18635012-18635034 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1135654278 16:24234038-24234060 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1135810161 16:25579602-25579624 CTCACGCAAGAAAGAATTCAGGG - Intergenic
1136084210 16:27873029-27873051 CTCATGCAAGAAAGAATTCAGGG - Intronic
1136639367 16:31549809-31549831 ATCACACAAGAAAGAATTCAGGG - Intergenic
1136930885 16:34416986-34417008 CTCACCCAAGAAAGAATTCAGGG + Intergenic
1136973688 16:34994822-34994844 CTCACCCAAGAAAGAATTCAGGG - Intergenic
1137013993 16:35354836-35354858 CTTGAACAAGAGTGGGTTCAAGG + Intergenic
1137277092 16:46942700-46942722 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1137402270 16:48163344-48163366 CTCACGCAAGAATGAATTCAGGG + Intergenic
1137695414 16:50458617-50458639 CTCGCACAAGAAAGAATTCAGGG - Intergenic
1138815990 16:60203179-60203201 CTCATGCAAGAAAGAATTCATGG - Intergenic
1138858488 16:60725244-60725266 ATCAATGAAGAGTGGATTCATGG + Intergenic
1139107435 16:63844032-63844054 TTCAAAAAAAAGTCAATTCATGG + Intergenic
1139217216 16:65138397-65138419 CTCAGACAAGAGTGAATTCTTGG - Intergenic
1139236978 16:65350089-65350111 CTGAAAAGAGAATGAATTCATGG + Intergenic
1139671885 16:68497687-68497709 CTCGCACAAGAAAGAATTCAGGG + Intergenic
1140058745 16:71548902-71548924 CTCACGCAAGAAAGAATTCAGGG - Intronic
1140281304 16:73557378-73557400 CTCACACAAGAAAGAATTCAGGG + Intergenic
1140352985 16:74280435-74280457 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1140499350 16:75419957-75419979 CTCGAACAAGAAAGAATTCGAGG - Intronic
1140744372 16:77968268-77968290 CTCACACAAGAGAGAATTCAGGG + Intronic
1141387201 16:83632699-83632721 CTCATGCAAGAAAGAATTCAGGG + Intronic
1141403115 16:83768520-83768542 CTCATGCAAGAAAGAATTCAGGG + Intronic
1141407441 16:83807086-83807108 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1141917941 16:87113004-87113026 CTCACTCAAGAAAGAATTCAGGG + Intronic
1143644689 17:8222796-8222818 CTGAGACAAGAGTGTCTTCAAGG - Intergenic
1145114171 17:20192921-20192943 CTCGCACAAGAATGAATTCAGGG + Intronic
1145244723 17:21260987-21261009 CTCACCCAAGAATGAATTCAGGG - Intergenic
1145768660 17:27476868-27476890 CTCATGCAAGAAAGAATTCAGGG + Intronic
1145855335 17:28151025-28151047 TCCAAACAAGAGTGAAAACAGGG - Intronic
1146133903 17:30301643-30301665 CTCGCACAAGAAAGAATTCAGGG + Intergenic
1146291147 17:31608154-31608176 CTCAGGCAAGAAGGAATTCAGGG + Intergenic
1146291543 17:31611068-31611090 CTCACACAAGAAAGAATTCAGGG + Intergenic
1146462201 17:33055148-33055170 CTCAAAACAGTGAGAATTCATGG + Intronic
1146501794 17:33370859-33370881 CTCACACAAGAAAGAATTCCAGG + Intronic
1146694892 17:34901299-34901321 CTCTCACAAGAAAGAATTCAGGG - Intergenic
1146915793 17:36677517-36677539 CTCACACAAGAAAGAATTTAGGG + Intergenic
1147361689 17:39934703-39934725 CTCACGCAAGAAAGAATTCAGGG + Intergenic
1147898479 17:43768079-43768101 CTCCCAGAAGACTGAATTCATGG - Exonic
1147925954 17:43946081-43946103 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1147990713 17:44331201-44331223 CTCATACAAGTGTGAAATGATGG + Intergenic
1148814738 17:50319356-50319378 CTCACGCAAGAAAGAATTCAGGG + Intergenic
1149269695 17:54964792-54964814 CTCAGACAAGATTGAAAACATGG - Exonic
1149781333 17:59398796-59398818 CTCACAAAAGAATGAGTTCATGG + Exonic
1150349475 17:64431494-64431516 CTCACACAAGAAAGAATTCTGGG + Intergenic
1151417888 17:73978521-73978543 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1151997435 17:77618785-77618807 AGCAAACAAGGGTGTATTCACGG - Intergenic
1152821024 17:82437748-82437770 CTCACACAGGAAAGAATTCAAGG + Intronic
1153575848 18:6520827-6520849 CTCAAGCAAGAGTAAAGACATGG - Intronic
1153603965 18:6812407-6812429 CTCACAAAAGAGTCTATTCAAGG + Intronic
1153817692 18:8805430-8805452 CACAAAAAAGAATGAAATCATGG - Intronic
1153889249 18:9497197-9497219 CTCGCACAAAAATGAATTCAGGG - Intronic
1155033986 18:22008703-22008725 CACACACAAGAGGGAATTCTGGG - Intergenic
1155041184 18:22066690-22066712 CTCCTACAGGAGTGAAATCAAGG - Intergenic
1155452039 18:25973635-25973657 CTCGCACAAGAAAGAATTCAGGG + Intergenic
1155452255 18:25975630-25975652 CTCACAGAAGAAAGAATTCAGGG - Intergenic
1155452369 18:25976503-25976525 CTCGCACAAGAAAGAATTCAGGG - Intergenic
1155850665 18:30769971-30769993 CTCAAGCAAGGGAGAATTCAGGG - Intergenic
1156096451 18:33538697-33538719 CACAAAAAAGAGGGTATTCAAGG + Intergenic
1156478825 18:37423499-37423521 CTCCACCAAGAATGACTTCAAGG - Intronic
1156556119 18:38070084-38070106 CTGAGATAAGAGTGCATTCATGG + Intergenic
1156815911 18:41310986-41311008 CTCACACAAGAAAGAATTTAGGG + Intergenic
1157224035 18:45846687-45846709 CTCGAGCAAGAAAGAATTCAGGG + Intergenic
1158291375 18:55948580-55948602 CTCCCACAAGAAAGAATTCAGGG - Intergenic
1158734721 18:60066566-60066588 CTCGCACAAGAAAGAATTCAGGG + Intergenic
1159676000 18:71285001-71285023 CTCACACAAGAAAGAATTCAGGG - Intergenic
1161640516 19:5419832-5419854 CTCGCACAAGAAAGAATTCAAGG - Intergenic
1163357639 19:16824635-16824657 CTCACGCAAGAAAGAATTCAGGG - Intergenic
1164518667 19:28959482-28959504 CTCAAGCAATAAAGAATTCAAGG - Intergenic
1164843382 19:31411582-31411604 CTCACACAAGAAAGAATTCAGGG + Intergenic
1165116526 19:33532496-33532518 CTCCCACAAGAAAGAATTCAGGG - Intergenic
1165145985 19:33730597-33730619 CTCACGCAAGAAAGAATTCAGGG + Intronic
1165340014 19:35204722-35204744 TTCCCACAAGAGAGAATTCAGGG + Intergenic
1165341494 19:35215397-35215419 CTCGCACAAGAAAGAATTCAGGG - Intergenic
1166391242 19:42409977-42409999 CTCAAACTCAAGTGACTTCAGGG + Intronic
1167200829 19:48063902-48063924 CTCATACAAGAAAGAATTCAGGG + Intronic
1168220188 19:54954965-54954987 CTCATACCAGAAAGAATTCAGGG - Intronic
1168489581 19:56796783-56796805 CTCACACAGGAAGGAATTCAAGG + Intronic
1168623283 19:57895834-57895856 CTCACACAAGAAAGAATTCAGGG + Intronic
925590543 2:5505190-5505212 CTCAGACAAGAGTGCATTCAGGG + Intergenic
925721038 2:6827580-6827602 CTCAAATAAGAAGGCATTCAAGG - Intergenic
925772259 2:7294157-7294179 CTCAAACTAGCATAAATTCAGGG - Intergenic
926340475 2:11900991-11901013 CTCACACAAGAAAGAATTCAGGG - Intergenic
926406389 2:12557394-12557416 CTCATGCAAGAAAGAATTCAGGG + Intergenic
926599663 2:14828624-14828646 ATGAAACAAGAGTGAAAACAAGG + Intergenic
927231162 2:20825474-20825496 CTCAAATAAGGGAGAATTGAAGG - Intergenic
927321389 2:21749942-21749964 CTCACGCAAGAAAGAATTCAGGG - Intergenic
927574870 2:24192502-24192524 CTCAAGCAAGAAAGAATTCACGG + Intronic
927771723 2:25868275-25868297 TTCAAACATCAGTGAGTTCAAGG + Intronic
929548497 2:42873894-42873916 CTCATGCAAGAAAGAATTCAGGG + Intergenic
930150150 2:48051089-48051111 CTCATGCAAGAAAGAATTCAGGG + Intergenic
930157414 2:48119563-48119585 CTCCCACAAGAAAGAATTCAGGG - Intergenic
930414925 2:51078903-51078925 CTCACACAAGGAAGAATTCAGGG - Intergenic
930434449 2:51322939-51322961 CTCACACAAGAAAGAATTCAGGG + Intergenic
930576751 2:53159801-53159823 CTCATGCAAGAAAGAATTCAGGG - Intergenic
930795594 2:55386816-55386838 CAAAAACAAGAGTGAAATAAAGG + Intronic
931018339 2:58012326-58012348 CTCATGCAAGAAAGAATTCAGGG - Intronic
931100250 2:58991386-58991408 CTCATGCAAGAAAGAATTCAGGG + Intergenic
931368578 2:61641050-61641072 CTCACACAAGAAAGAATTCGGGG - Intergenic
931369478 2:61649100-61649122 CTCACCCAAGAAAGAATTCAGGG - Intergenic
931406349 2:61982469-61982491 ATCAAACAAGAGAGAAATAAAGG - Intronic
931665143 2:64605099-64605121 CTCAACCCAGGGTGAATCCAGGG + Intergenic
932513296 2:72317697-72317719 CTCAAACAATAGTAAATTGGCGG - Intronic
932827482 2:74955169-74955191 CTCACACAAGAAAGAATTCAGGG - Intergenic
932860827 2:75289584-75289606 CTCACACAAGAAAGAATTCAGGG - Intergenic
933005130 2:76982629-76982651 AGGAACCAAGAGTGAATTCAGGG + Intronic
933613937 2:84464457-84464479 CTCATGCAAGAAAGAATTCAGGG + Intergenic
933656716 2:84894548-84894570 CTTCAATAGGAGTGAATTCAAGG + Intronic
934029236 2:88026843-88026865 CTCACGCAAGAAAGAATTCAGGG - Intergenic
934888608 2:98046637-98046659 CTCACCCAAGAAAGAATTCAGGG - Intergenic
935095511 2:99940781-99940803 CTCATGCAAGAAAGAATTCAGGG - Intronic
935115059 2:100128275-100128297 CTCACGCAAGAAAGAATTCAGGG - Intronic
935318642 2:101863116-101863138 CCCCAACAATAGTCAATTCAGGG + Intronic
935333352 2:101993830-101993852 CTCACACAAGAGAGAACTCAGGG - Intronic
935471775 2:103469466-103469488 CTCTCACAAGAAAGAATTCAAGG + Intergenic
935472871 2:103480432-103480454 CTCACACAAGAAAGAATTCGAGG + Intergenic
935596988 2:104886557-104886579 CTCGCACAAGAAAGAATTCAGGG + Intergenic
937054974 2:118926980-118927002 TTCAACCAAGACTGAAGTCAAGG - Intergenic
937164530 2:119799652-119799674 TTCCAAGAAGAGTGAATTCTGGG - Intronic
937711384 2:124984332-124984354 CTCAGGCAAGAAAGAATTCAGGG - Intergenic
938085384 2:128396521-128396543 GGCAAACAAGGGTGACTTCATGG - Intergenic
938192535 2:129296738-129296760 ACCATACAAGAGGGAATTCAGGG + Intergenic
938676272 2:133638102-133638124 CTCACTCAAGAATGAAGTCAAGG + Intergenic
939197388 2:138990130-138990152 CTCACACAAGAAAGAATTCAGGG - Intergenic
939253570 2:139715014-139715036 CTCTCACAAGAAAGAATTCAGGG + Intergenic
939819924 2:146945406-146945428 CTCAAGCAAGACTGAGCTCAAGG + Intergenic
940313535 2:152304324-152304346 CTCATGCAAGAAAGAATTCAAGG - Intergenic
940775420 2:157878579-157878601 CTCACGCAAGAAAGAATTCAGGG - Intronic
941444511 2:165583882-165583904 CTCACACAAGAAGGAATTCAGGG + Intronic
942005087 2:171690158-171690180 GTCAGACAAAAGTGAATTAAAGG + Exonic
942078997 2:172382875-172382897 CTCATGCAAGAAAGAATTCAGGG - Intergenic
942127225 2:172839241-172839263 CTCACACAAGAAAGAATTCAGGG + Intronic
942588949 2:177519788-177519810 CTCACACAAGAAAGAATTCAGGG + Intronic
942767026 2:179469426-179469448 CTCACACAAGAAAGAATTCGGGG - Intronic
942870197 2:180725511-180725533 CTCAGGCAAGAAAGAATTCAGGG + Intergenic
943467024 2:188240584-188240606 CTCACACAAGAAAGAATTCAGGG - Intergenic
943548206 2:189308022-189308044 CTCACACAAGAAAGAATTCAGGG - Intergenic
944042244 2:195368822-195368844 CTCATGCAAGAAAGAATTCACGG + Intergenic
944149060 2:196537998-196538020 CTCCCACAAGAAAGAATTCAGGG - Intronic
944520199 2:200557525-200557547 CTCACACAAGAAAGAATTCAAGG + Intronic
944714067 2:202361605-202361627 CTCCAGCAAGAAAGAATTCAGGG + Intergenic
945109068 2:206345345-206345367 CTCACACAAGAAAGAATTCAGGG + Intergenic
945902038 2:215549534-215549556 CTCATGCAAGAAAGAATTCAGGG + Intergenic
946016511 2:216608249-216608271 CTCATGCAAGAAAGAATTCAGGG + Intergenic
946110254 2:217408689-217408711 CTCATGCAAGAAAGAATTCAGGG + Intronic
946114417 2:217448788-217448810 CTCAAGGAAGAAAGAATTCAGGG + Intronic
946441295 2:219698871-219698893 CTCAATCTGCAGTGAATTCAGGG + Intergenic
946565525 2:220960559-220960581 CTCACCCAAGAAAGAATTCAGGG + Intergenic
946730501 2:222704941-222704963 CTCACACAAGAAAGAATTCAGGG + Intronic
947088691 2:226485240-226485262 CTCACATAAGAAAGAATTCAGGG - Intergenic
947498419 2:230655644-230655666 CTCATGCAAGAAAGAATTCAGGG - Intergenic
947968504 2:234302286-234302308 CACAGGCAAGAGTGAAGTCAGGG + Intergenic
948094402 2:235322021-235322043 CTCATGCAAGAAAGAATTCAGGG - Intergenic
948308364 2:236966998-236967020 CTCCAGCAAGAAAGAATTCAGGG + Intergenic
948329402 2:237153245-237153267 CTCACTCAAGAAAGAATTCAGGG - Intergenic
1168823166 20:790836-790858 CTCACACAAGAAAGAATCCAGGG - Intergenic
1168844384 20:933748-933770 CTCACACAAGATGGAAGTCAAGG + Intergenic
1169180163 20:3557488-3557510 CTCAAACAAGAGTGAATTCAGGG + Intronic
1170635071 20:18097085-18097107 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1171023701 20:21609710-21609732 TTCAAAGAAGAATGAATTGATGG - Intergenic
1171171686 20:23020980-23021002 CTCACTCAAGAAAGAATTCAAGG - Intergenic
1171327588 20:24309193-24309215 CTCGCACAAGAAAGAATTCAAGG - Intergenic
1171538039 20:25915418-25915440 CTCACACAGGAAAGAATTCAAGG + Intergenic
1171840975 20:30210717-30210739 CTCACACAGGAAAGAATTCAAGG + Intergenic
1173076887 20:39827908-39827930 CTCACTCAAGAAAGAATTCAGGG - Intergenic
1173158434 20:40634325-40634347 CTCATAAAAGGGTGGATTCAAGG - Intergenic
1173448599 20:43142445-43142467 CTCAAAGAAGAGTGAGTCCCAGG + Intronic
1173492459 20:43494170-43494192 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1173563177 20:44020792-44020814 CTAAAACAACTGAGAATTCAGGG - Intronic
1174143296 20:48432197-48432219 CTCACACAAGAAAGAATTCAGGG + Intergenic
1174243916 20:49161905-49161927 TTCAAAAGAGAGTGAAGTCAGGG + Intronic
1174670421 20:52302540-52302562 CTCATGCAAGAAAGAATTCAAGG - Intergenic
1174703259 20:52630575-52630597 ATCTAACAAGACTGAAATCAAGG - Intergenic
1174791658 20:53483998-53484020 GTGAAACAAGAGTGAAGTCCTGG - Intronic
1174882106 20:54291229-54291251 CTCAAGCAAGAAAGAATTCAGGG - Intergenic
1174902905 20:54519816-54519838 CTTAAAGAAGTATGAATTCAAGG - Intronic
1175010449 20:55729241-55729263 CTCACTCAAGAAAGAATTCAGGG - Intergenic
1175144281 20:56884004-56884026 CTCACGCAAGAAAGAATTCAGGG + Intergenic
1175181449 20:57150906-57150928 CTCACACAAGAAAGAATTCAGGG + Intergenic
1175481061 20:59311284-59311306 CTCGAGCAAGAAAGAATTCAAGG + Intronic
1175635282 20:60577686-60577708 CTCGCACAAGAAAGAATTCAAGG + Intergenic
1176413829 21:6463540-6463562 CTCAATCCAGAGTGACTACAGGG + Intergenic
1176581058 21:8526676-8526698 CTCACACAGGAAAGAATTCAAGG - Intergenic
1177024663 21:15907197-15907219 CTAGAACAAGAGTGAAGTAAAGG - Intergenic
1177228799 21:18292363-18292385 CTCACACAGGAAGGAATTCAAGG - Intronic
1177486468 21:21763098-21763120 CTCCAACAATATTGATTTCATGG - Intergenic
1177749683 21:25264575-25264597 TTCACACAAGAAAGAATTCAGGG - Intergenic
1177799147 21:25810337-25810359 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1177806356 21:25878834-25878856 CTCATGCAAGAAAGAATTCAAGG - Intergenic
1178112950 21:29387334-29387356 CTCACACAAGAAAGAATTCAGGG + Intronic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178198198 21:30372470-30372492 GTCAAACCACAGTGAATTCCAGG - Intronic
1178280440 21:31277774-31277796 CTCGCACAAGAAAGAATTCAGGG - Intronic
1178459596 21:32790637-32790659 CTCACATAAGAAAGAATTCAAGG + Intergenic
1178477396 21:32949281-32949303 CTCACGCAAGAAAGAATTCAGGG - Intergenic
1178601310 21:33997046-33997068 CTGACACAAGAGTAAAATCAGGG - Intergenic
1179186331 21:39087723-39087745 CTCCAACAAAACTGACTTCATGG + Intergenic
1179245220 21:39627340-39627362 CTTTACCAAGAGTGAGTTCATGG - Intronic
1179689327 21:43071862-43071884 CTCAATCCAGAGTGACTACAGGG + Intronic
1180131828 21:45831660-45831682 CTCACACAAGAAAGAATTCAGGG + Intronic
1181641754 22:24204482-24204504 CTCCAGCAAGAAAGAATTCAGGG - Intergenic
1182521443 22:30886883-30886905 CTCACACAAGAAAGAATTCAAGG + Intronic
1182944041 22:34305525-34305547 CTCATGCAAGAAAGAATTCAAGG - Intergenic
1183113292 22:35669169-35669191 CTCGCACAAGAAAGAATTCAGGG - Intergenic
1183589637 22:38772499-38772521 CTCGTGCAAGAATGAATTCAGGG - Intronic
1184896332 22:47409266-47409288 CTCACATAAGAAAGAATTCAGGG - Intergenic
949200679 3:1375306-1375328 CTGAAACAAGAGAGTATTAATGG - Intronic
949814493 3:8043407-8043429 CTAAAACAAGCCTCAATTCATGG + Intergenic
950229983 3:11268103-11268125 CTCACACAAGAAAGAATTCTGGG + Intergenic
950511399 3:13430311-13430333 CTCACACAAGAAAGAATTCAGGG + Intergenic
950593156 3:13953722-13953744 CTCAAGCAAGAAAGAATTCAAGG + Intronic
951104877 3:18731079-18731101 CACATACATGAGTGAATTCCAGG - Intergenic
952070639 3:29630951-29630973 CTGAAATAAGAGTGAAGTTATGG - Intronic
952124267 3:30281019-30281041 CTCACACAAGTAAGAATTCAGGG - Intergenic
952559065 3:34568484-34568506 CTCATGCAAGAAAGAATTCAAGG + Intergenic
953077890 3:39587537-39587559 CTCATGCAAGACAGAATTCAGGG + Intergenic
953152323 3:40335786-40335808 CTCACACAAGAAGGAATTCAAGG + Intergenic
953416061 3:42718520-42718542 CTCATGCAAGAAAGAATTCAGGG - Intronic
953609633 3:44436958-44436980 CTCGCACAAGAAAGAATTCAGGG + Intergenic
953684028 3:45062047-45062069 CTCACACAAGAGAGAATTCAGGG - Intergenic
953684114 3:45062692-45062714 CTCACACAAGAAAGAATTCGGGG - Intergenic
955006950 3:54977787-54977809 CTCATACAAGAAAGAATTCATGG + Intronic
955045919 3:55359547-55359569 CTCACACACGAAAGAATTCAGGG - Intergenic
955209091 3:56924444-56924466 CTCATGCAAGAAAGAATTCAGGG + Intronic
955259089 3:57366433-57366455 CTCATGCAAGAAAGAATTCAGGG - Intronic
955380803 3:58436243-58436265 CTCACACAAGAAAGAATTCAGGG + Intergenic
956054045 3:65279501-65279523 CTCATGCAAGAAAGAATTCAGGG + Intergenic
956384046 3:68698081-68698103 CTTGCACAAGAGTGAACTCAAGG + Intergenic
956414901 3:69015253-69015275 CTCGAGCAAGAAAGAATTCAGGG - Intergenic
956573841 3:70729128-70729150 CACAAAGCAGAGTGCATTCAAGG + Intergenic
957539194 3:81546861-81546883 CTCAGGCAAGAAAGAATTCAGGG - Intronic
958712806 3:97738842-97738864 CTCAAACAAAAGTATATTAATGG - Intronic
960514630 3:118590120-118590142 CTCATGCAAGAAAGAATTCAGGG - Intergenic
960627912 3:119699513-119699535 CTCACGCAAGACAGAATTCAGGG - Intergenic
960664913 3:120099433-120099455 CTCACACAAGAAAGAATTCAGGG + Intergenic
961993403 3:131216124-131216146 GGAAAGCAAGAGTGAATTCAGGG + Intronic
962049006 3:131793189-131793211 CTAGACCAAGAGTGACTTCATGG + Intronic
962278278 3:134031497-134031519 GTCAGACAAGGCTGAATTCAGGG - Intronic
962770983 3:138609859-138609881 CTAAAACAAGATAGAATCCACGG + Intronic
963171788 3:142258291-142258313 CTCAAGCAAGAAAGAATTCAGGG - Intergenic
963234849 3:142946646-142946668 CTCATACAAGAAAGAATTCAGGG + Intergenic
964856272 3:161149417-161149439 CTCACGCAAGAAAGAATTCAGGG - Intronic
965161174 3:165135550-165135572 CTTATACAAAAATGAATTCAAGG - Intergenic
965397636 3:168178755-168178777 CTGCAACAAGAGTAAATTCTAGG - Intergenic
965444305 3:168755779-168755801 ATCAAACCAGAATGAATTAAAGG - Intergenic
965612760 3:170562310-170562332 CATAAAGAAGAATGAATTCATGG + Intronic
966106952 3:176347424-176347446 CTCACACAAGAAAGAATTCAGGG + Intergenic
966654936 3:182345598-182345620 CTCATACAAAAATTAATTCAAGG + Intergenic
966721090 3:183063656-183063678 CTCACACAAGAAAGAATTCAGGG - Intronic
967960847 3:194922699-194922721 CTCACACAAGGAAGAATTCAGGG - Intergenic
968042790 3:195601736-195601758 CTCATGCAAGAAAGAATTCAAGG + Intergenic
968892671 4:3379149-3379171 CTCTAAAAACATTGAATTCATGG + Intronic
968972693 4:3804142-3804164 CTGAGACAAGGGTGACTTCAGGG - Intergenic
969635044 4:8364050-8364072 CTCATGCAAGAAAGAATTCAGGG - Intergenic
969964624 4:10981389-10981411 CTCAAGCAAGAAAGAATTCAAGG + Intergenic
970054097 4:11951395-11951417 CTCGCACAAGAAAGAATTCAGGG - Intergenic
970220277 4:13803381-13803403 CTTAAACAAAAATCAATTCAAGG + Intergenic
970802400 4:19989039-19989061 CACAAACAAGATAGAATTCCAGG + Intergenic
971005867 4:22374019-22374041 CTCACACAAGAAAGAATTCAGGG - Intronic
971561164 4:28081171-28081193 CTCATACAAAAATTAATTCAAGG + Intergenic
971837141 4:31782173-31782195 CTTAAAGAAGAGGGAATTTATGG + Intergenic
971998464 4:33996899-33996921 CTCATGCAAGAAAGAATTCAGGG - Intergenic
972053803 4:34774527-34774549 CTCACACAAGAAAGAATTCAGGG - Intergenic
972297420 4:37753350-37753372 CTCATGCAAGAAAGAATTCAGGG - Intergenic
972723122 4:41720802-41720824 CTCACACAAGAAAGAATTCAAGG - Intergenic
972921322 4:43945975-43945997 CTCACACAAGAAAGAATTCAGGG + Intergenic
973336063 4:48957784-48957806 CTCATGCAAGAAAGAATTCAGGG - Intergenic
974052063 4:56950580-56950602 CTCACGCAAGAAAGAATTCAGGG + Intergenic
974174096 4:58304156-58304178 CTCATACAAGAAAGAATTCAGGG - Intergenic
974179426 4:58364465-58364487 CTCACACAAGAAAGAATTCAGGG + Intergenic
975043054 4:69768915-69768937 CTCATGCAAGAAAGAATTCAGGG - Intronic
975206295 4:71647580-71647602 CTCATGCAAGAAAGAATTCAGGG + Intergenic
975340147 4:73230862-73230884 CTGGAAAAAGAATGAATTCATGG - Intronic
975781814 4:77848196-77848218 CTCACACAAGAAAGAATGCAGGG + Intergenic
976178792 4:82380072-82380094 CTAAAAAAATAGTCAATTCATGG - Intergenic
976747133 4:88414465-88414487 CTCACACAAGAAATAATTCAGGG + Intronic
977345788 4:95814371-95814393 TTCAAACAAGAGTGAATTCCTGG - Intergenic
977499702 4:97823600-97823622 CTCACACAAAAAAGAATTCAAGG - Intronic
977674731 4:99734422-99734444 CTCGTACAAGAAAGAATTCAGGG + Intergenic
977715219 4:100174611-100174633 CTCAAACCAGAATAGATTCAGGG - Intergenic
977829249 4:101571011-101571033 CTCACGCAAGAAAGAATTCAGGG + Intronic
978683943 4:111416003-111416025 CTCAAAAAAGGCTGAATCCAGGG - Intergenic
978995722 4:115149366-115149388 TTCACACAAGAAAGAATTCAGGG + Intergenic
979361875 4:119774716-119774738 CTCACACAAGAAATAATTCAGGG + Intergenic
979728512 4:123993440-123993462 TTCAGACAAAAGTGATTTCAAGG - Intergenic
980528519 4:134020136-134020158 CTCATGCAAGAAAGAATTCAGGG + Intergenic
980612282 4:135174458-135174480 CTCACACAAGAAAAAATTCAGGG + Intergenic
980829294 4:138110242-138110264 CTCATGCAAGAAAGAATTCAGGG - Intergenic
980875882 4:138661547-138661569 CTCATGCAAGAAAGAATTCAGGG + Intergenic
980896045 4:138861466-138861488 CTCAAATCAGGGTGAATACACGG + Intergenic
981608372 4:146564837-146564859 CTCACCCAAGAAAGAATTCAGGG - Intergenic
981880867 4:149610712-149610734 CTCAAACGAAAATGAATTAAAGG + Intergenic
982265796 4:153537337-153537359 CTCACACAAGAAAGAATTCAAGG + Intronic
982331553 4:154186912-154186934 CTCACACAAGAAATAATTCAGGG - Intergenic
982345714 4:154355588-154355610 CTCACGCAAGAATGAATTCAGGG - Intronic
983592517 4:169429612-169429634 CTCAAAGAAGAGTGAGTAAAAGG - Intronic
983733004 4:171021198-171021220 CTCACGCAAGAAAGAATTCAGGG - Intergenic
983995291 4:174175094-174175116 CTCACTCAAGAAAGAATTCAGGG + Intergenic
984096749 4:175444298-175444320 CTCACACAAGAAAGAATTCAGGG + Intergenic
984170808 4:176357336-176357358 TTCACACAAGAAAGAATTCAAGG + Intergenic
984223409 4:177005473-177005495 CTCATGCAAGAAAGAATTCAGGG + Intergenic
984428603 4:179619909-179619931 AGCAAACAAGAGTGAATTGTAGG - Intergenic
984507598 4:180639161-180639183 CTCACACAAGAAAGAATTCAGGG + Intergenic
984650817 4:182268948-182268970 CTCACACAAGAAAGAATTCAGGG - Intronic
984904603 4:184615032-184615054 CTCACGCAAGAAAGAATTCAAGG + Intergenic
984994239 4:185412914-185412936 CTCAAATAAGAGTGAATTGGCGG - Intronic
985698474 5:1356589-1356611 CTCGCACAAGATAGAATTCAGGG + Intergenic
986194278 5:5523828-5523850 CTCACGCAAGAAAGAATTCAGGG - Intergenic
986252623 5:6074511-6074533 CTCACACAAGAAAGAATTCAAGG + Intergenic
987195318 5:15519864-15519886 CTCTCACAAGAAAGAATTCAGGG + Intronic
987200762 5:15575417-15575439 CACAAACAAGAGTGTTTTCTTGG + Intronic
987229575 5:15879547-15879569 ATCACAGAAGAGTGAATTCTTGG + Intronic
987373231 5:17212161-17212183 CTCATGCAAGAAAGAATTCAGGG + Intronic
987905540 5:24071363-24071385 CACAAACAAGATTGAACACATGG - Intronic
988452971 5:31361771-31361793 CTCTCACAAGAAAGAATTCAGGG + Intergenic
988453180 5:31363593-31363615 CTCACGCAAGAAAGAATTCAGGG + Intergenic
988550356 5:32195526-32195548 TTCAAACAAGAATCAATTCTAGG + Intergenic
988831409 5:34990809-34990831 CTCACACAAGAAAGAATTCAGGG - Intergenic
989130248 5:38100167-38100189 CTCACACAAGAAAGAATTCGGGG - Intergenic
989160718 5:38388257-38388279 CTCAAAGTTGAGTGACTTCAAGG - Intronic
990024338 5:51167128-51167150 GTCAAGCAACAGTGAGTTCAAGG + Intergenic
990076819 5:51856216-51856238 CTCTCACAAGAGAGAATTCATGG + Intergenic
991297810 5:65100224-65100246 CTCACACAGGAAAGAATTCAAGG + Intergenic
991432624 5:66563945-66563967 CTCATGCAAGAAAGAATTCAGGG - Intergenic
992851905 5:80818792-80818814 CTCAAACAATGATCAATTCATGG - Intronic
992865791 5:80956052-80956074 CTCTCACAAGAAAGAATTCAGGG + Intergenic
994635203 5:102337855-102337877 CTCATGCAAGAAAGAATTCAGGG + Intergenic
995110280 5:108421241-108421263 TTCACACAAGAAAGAATTCAGGG + Intergenic
995261218 5:110106565-110106587 CTCACATAAGAAAGAATTCAGGG - Intergenic
995794754 5:115929636-115929658 CTCGTGCAAGAATGAATTCAGGG + Intergenic
996293245 5:121879573-121879595 CTCATACAAGAAAGAATTCAGGG + Intergenic
996351137 5:122543131-122543153 CTTGAACAAGAAAGAATTCAGGG - Intergenic
996707737 5:126514024-126514046 CTCACACAAGAAAGAATTCGAGG + Intergenic
996890119 5:128408918-128408940 CTGAAACAAGAGTATCTTCAGGG - Intronic
996925771 5:128824416-128824438 CTCGCACAAGAAAGAATTCAGGG - Intronic
996998527 5:129728512-129728534 CTCTTACAAGATAGAATTCAGGG - Intronic
997099404 5:130952494-130952516 CTCACACAAGAAAGAATTCAAGG + Intergenic
998507526 5:142684068-142684090 CTCAAGCAAGAAAGAAGTCAGGG - Intronic
998942421 5:147299039-147299061 CTCACGCAAGAAAGAATTCAGGG + Intronic
999514008 5:152282316-152282338 CTCAAAAAAGAGAAAAGTCAAGG - Intergenic
999585005 5:153080486-153080508 CTCGCACAAGAAAGAATTCAGGG - Intergenic
999749515 5:154616747-154616769 CTTATACAAAAATGAATTCAAGG + Intergenic
1000066235 5:157695212-157695234 CTCCCACAAGAAAGAATTCAGGG - Intergenic
1000154321 5:158535732-158535754 TTAAAATAAGAGTGTATTCAGGG + Intergenic
1000162485 5:158612747-158612769 CTCAATCAAGAAAGGATTCATGG - Intergenic
1000600899 5:163273486-163273508 CTCGCACAAGAAAGAATTCAGGG + Intergenic
1000724846 5:164757147-164757169 ATCAAATAAGAGTGAAGTTAGGG - Intergenic
1001230417 5:169982424-169982446 TTCAAAGAAGAGGGAAATCAAGG - Intronic
1001510264 5:172315849-172315871 CTCACGCAAGAAAGAATTCAGGG - Intergenic
1002005377 5:176228955-176228977 CTCCAACAATTGTCAATTCAAGG + Intergenic
1002029815 5:176419511-176419533 CTCACGCAAGAAAGAATTCAGGG - Intergenic
1002220999 5:177681665-177681687 CTCCAACAATTGTCAATTCAAGG - Intergenic
1002977182 6:2091998-2092020 CTCAGGGAAGAGTGGATTCATGG + Intronic
1004389362 6:15197213-15197235 CTCGCACAAGAAAGAATTCAAGG + Intergenic
1004608929 6:17220281-17220303 TTCACACAAGAAAGAATTCAGGG + Intergenic
1005448945 6:25954427-25954449 CTCACACAAGAAAGAATTTAGGG + Intergenic
1007340630 6:41189008-41189030 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1008291566 6:49722094-49722116 CTCAGAGAAGAAAGAATTCAGGG + Intergenic
1008434630 6:51461169-51461191 GTTGAACAAGATTGAATTCAAGG + Intergenic
1008515594 6:52315969-52315991 CTAAAACAATATTGAATTAAAGG + Intergenic
1008559532 6:52710224-52710246 CTCACACAAGAAAGAATTCAGGG - Intergenic
1008928142 6:56909056-56909078 CTCCCACAAGAAAGAATTCAGGG - Intronic
1009646608 6:66411544-66411566 CTCACGCAAGAAAGAATTCAGGG + Intergenic
1011257460 6:85437693-85437715 CTCGCACAAGAAAGAATTCAGGG - Intergenic
1011594935 6:89007290-89007312 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1011924481 6:92625469-92625491 CTTATACAAAAGTTAATTCAAGG - Intergenic
1011939404 6:92824225-92824247 CTCGCACAAGAAAGAATTCAGGG - Intergenic
1012378853 6:98595597-98595619 CTCAAACATAAAAGAATTCATGG - Intergenic
1012984721 6:105863694-105863716 CTCAAACTAGATAGAATTCATGG + Intergenic
1013179105 6:107703259-107703281 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1013364413 6:109425001-109425023 CTCTCACAAGAAAGAATTCAGGG - Intronic
1014134509 6:117873025-117873047 CTCAAAGAAGAGTGTGTTAAAGG - Intergenic
1014156192 6:118112538-118112560 CTCACACAAGAAAGAATTCAGGG - Intronic
1014933519 6:127361434-127361456 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1014937171 6:127398341-127398363 CTCGCACAAGAAAGAATTCAGGG - Intergenic
1015183872 6:130391421-130391443 CTCAAAGAAGAGGGAAATCTGGG + Intronic
1015288339 6:131509744-131509766 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1015888511 6:137945624-137945646 GTAAAACCAGAGTGAATTTAGGG - Intergenic
1016006335 6:139092709-139092731 CTCACACAAGAAAGAATTCAAGG - Intergenic
1016012853 6:139156943-139156965 CTCGCACAAGAAAGAATTCAGGG + Intronic
1016406836 6:143739963-143739985 CTCGGACAAGAAAGAATTCAGGG + Intronic
1016443759 6:144111412-144111434 CTCACACAAAAGTCAATTCCAGG + Intergenic
1016668494 6:146672592-146672614 CTCACACAGTAGGGAATTCAAGG + Intronic
1016699226 6:147034942-147034964 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1016733326 6:147449316-147449338 CTCACACAAGAAAGAATTCGAGG + Intergenic
1016832154 6:148444751-148444773 CTCATGCAAGAAAGAATTCAGGG + Intronic
1017292610 6:152758204-152758226 CTCAAACTAAAGGCAATTCATGG + Intronic
1017983639 6:159423778-159423800 CTCAGTCAAGTCTGAATTCAGGG + Intergenic
1018077188 6:160228140-160228162 CTCACACATGAAAGAATTCAGGG - Intronic
1018078490 6:160238146-160238168 CTCACACAAGAAGGAATTCAGGG - Intronic
1018357246 6:163030557-163030579 CTCACACAAGAAAGAATTCAGGG + Intronic
1018363838 6:163098651-163098673 CTCACGCAAGACAGAATTCAGGG + Intronic
1018897294 6:168028729-168028751 CTCAAACAAGTGAAAAGTCACGG - Intronic
1019007207 6:168808922-168808944 CTCACACAAGAAGGAATTCAGGG + Intergenic
1019296412 7:278025-278047 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1019791489 7:3016933-3016955 CTCATGCAAGAAGGAATTCAGGG - Intronic
1020236591 7:6360608-6360630 CTCAGAAAAGATAGAATTCAGGG - Intergenic
1020535551 7:9391812-9391834 CTCACACAAGAAAAAATTCAGGG - Intergenic
1021573769 7:22089812-22089834 TTCACACAAGAAAGAATTCAGGG + Intergenic
1022200523 7:28112688-28112710 CTCAAACAAGAATGAATGGTGGG + Intronic
1022553363 7:31264083-31264105 CACAAACAAAACTTAATTCAAGG - Intergenic
1022747238 7:33184767-33184789 CTCAAACAAGAAAGAATTCAGGG + Intronic
1023214711 7:37849087-37849109 CACAAACAAGACTGTATTCCAGG - Intronic
1023568321 7:41547104-41547126 CTCACACAAGAAAGAATTCAGGG + Intergenic
1023580150 7:41672974-41672996 CTCACGCAAGAAAGAATTCAGGG + Intergenic
1024146528 7:46522835-46522857 GTCACACAAGAAAGAATTCAGGG - Intergenic
1024304945 7:47921708-47921730 CTATAAGAAGAGTGAATTAATGG + Intronic
1025111288 7:56218446-56218468 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1025241719 7:57282197-57282219 GTCACACAAGAAAGAATTCAGGG - Intergenic
1026084840 7:67254478-67254500 CTTGCACAAGAGAGAATTCAGGG + Intergenic
1026097923 7:67361555-67361577 CTCACACAAGAAAGAATTCAGGG - Intergenic
1026119171 7:67521673-67521695 CTCACACAAGAAAGAATTCAGGG - Intergenic
1026166495 7:67914751-67914773 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1026222279 7:68410632-68410654 CCCACACAAGAAAGAATTCAGGG + Intergenic
1026227302 7:68453516-68453538 CTCACACAAGAAAGAAATCAGGG + Intergenic
1026253769 7:68693124-68693146 CTCACACAAGAAACAATTCAGGG - Intergenic
1026288395 7:68984221-68984243 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1026306620 7:69148015-69148037 CTCACACAAGAAAGAATTCAGGG + Intergenic
1026611097 7:71860555-71860577 CTCACCCAAGAAAGAATTCAGGG - Intronic
1026692333 7:72560442-72560464 CTTGCACAAGAGAGAATTCAGGG - Intronic
1026861338 7:73791997-73792019 CTCACACAAGAAAGAATTCAGGG - Intergenic
1027161795 7:75808132-75808154 CTCACACAAGAAGGAATTCAGGG - Intergenic
1027259500 7:76454596-76454618 CTCACGCAAGAAAGAATTCAGGG + Intergenic
1027282978 7:76622288-76622310 CTCACGCAAGAAAGAATTCAGGG - Intronic
1027310871 7:76952680-76952702 CTCACGCAAGAAAGAATTCAGGG + Intergenic
1027783279 7:82547298-82547320 ATCAAATCAGAGTAAATTCAGGG - Intergenic
1027912377 7:84267686-84267708 CTAAAATAAAAGTGATTTCATGG + Intronic
1028158411 7:87458124-87458146 CTCAAACAAGAGGCAATGCAAGG + Intronic
1028227045 7:88264882-88264904 CTCACGCAAGAAAGAATTCAGGG + Intergenic
1028650836 7:93149418-93149440 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1029588519 7:101491437-101491459 CTCACACAAGAAAGAATTGAGGG + Intronic
1029798482 7:102921149-102921171 CTCAAAACAAAGCGAATTCAAGG + Intronic
1029834442 7:103295025-103295047 CTCAAACATGAAAGAATTAAAGG + Intergenic
1030187087 7:106774676-106774698 CTCACGCAAGAAAGAATTCAAGG + Intergenic
1030190042 7:106801324-106801346 CTCACTCAAGAAAGAATTCAGGG + Intergenic
1030224092 7:107129602-107129624 CTCGCACAAAAATGAATTCAGGG + Intronic
1030316266 7:108117604-108117626 CTCACACAAGAAAGAATTCAGGG + Intronic
1030641908 7:112015507-112015529 CTCAAGCAAGAAAGAATTCAGGG - Intronic
1031263668 7:119555864-119555886 CTCCCACAAGAAAGAATTCAGGG + Intergenic
1031461180 7:122051259-122051281 CTAAAACAAGGTTAAATTCAAGG + Intronic
1031493395 7:122417589-122417611 CTCAAAGAAGCATGAAGTCAAGG + Intronic
1031533683 7:122908055-122908077 CTCACACAAGAAAGAATTCAGGG + Intergenic
1031915018 7:127554758-127554780 GTCAATCAGGAGTGAATTCTGGG - Intergenic
1032068454 7:128790311-128790333 CTCACGCAAGAAAGAATTCAGGG - Intergenic
1032123028 7:129170337-129170359 CTGACACAAGAAAGAATTCAGGG + Intergenic
1032136898 7:129287861-129287883 CTTCAACAATTGTGAATTCATGG + Intronic
1032613421 7:133440957-133440979 CTCACACAAGAAATAATTCAGGG - Intronic
1032670964 7:134082057-134082079 CTCACACAAGAAAGAATTCAGGG + Intergenic
1033162155 7:139007137-139007159 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1033351556 7:140566380-140566402 CTCACACAAGAAAGAATTCAGGG - Intronic
1033546954 7:142409917-142409939 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1033577951 7:142704269-142704291 CTCAAGCAAGAAAGAATTCAGGG - Intergenic
1033662630 7:143412971-143412993 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1034249984 7:149681806-149681828 CTCACACAAGAAAGAATTCAGGG + Intergenic
1034335749 7:150322758-150322780 CTCATGCAAGAAAGAATTCAGGG - Intronic
1034687141 7:152982340-152982362 CTCACGCAAGAAAGAATTCAAGG - Intergenic
1034788418 7:153946148-153946170 CTCACGCAAGAAGGAATTCAGGG + Intronic
1035148584 7:156845828-156845850 CTCAGACAAGGCTGAATTTAAGG + Intronic
1035451815 7:158981835-158981857 CTCACACAAGAGGGAATTCAAGG - Intergenic
1035837371 8:2769213-2769235 ATCAAAACAGAGTAAATTCAGGG + Intergenic
1036146786 8:6261427-6261449 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1036459211 8:8937054-8937076 CTCACACAAGAAAGAATTCAGGG - Intergenic
1036460178 8:8945616-8945638 CTCACAAAAGAAAGAATTCAGGG - Intergenic
1036480908 8:9138919-9138941 CTCAAAAAAGAGAGACTTCCGGG - Exonic
1036641079 8:10584303-10584325 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1036973267 8:13379814-13379836 CTCAAAAAAGATTGAGTTCATGG + Intronic
1037163671 8:15801035-15801057 CTCACCCAAGAAAGAATTCAGGG + Intergenic
1037304307 8:17489283-17489305 CTCTCACAAGAAAGAATTCAGGG + Intergenic
1037614667 8:20507978-20508000 CTCACGCAAGAAAGAATTCAAGG - Intergenic
1038325884 8:26572432-26572454 CTCAAGCAGGACTGAATGCAGGG - Intronic
1038413600 8:27376934-27376956 CTCACACAAGAAAGAATTGAGGG - Intronic
1038439581 8:27561929-27561951 CTCGCACAAGAAAGAATTCAGGG + Intergenic
1038888964 8:31696940-31696962 CACAAATAATAGTGAAGTCAGGG + Intronic
1039073132 8:33664069-33664091 CACAAACAAAATTTAATTCATGG + Intergenic
1039261593 8:35777508-35777530 CTCAAAAAATAGTGAAATCATGG + Intronic
1039302151 8:36221289-36221311 CTCATGCAAGAAGGAATTCAGGG + Intergenic
1039882199 8:41632102-41632124 CTCTCACAAGAAAGAATTCAGGG - Intergenic
1040033265 8:42844939-42844961 CTCACGCAAGACAGAATTCAGGG - Intergenic
1040367227 8:46730370-46730392 CTCATACAAAAATTAATTCAAGG + Intergenic
1040389465 8:46937445-46937467 CTGAAACAACAGTGAACTCTGGG - Intergenic
1041068728 8:54105721-54105743 CTCACGCAAGAGAGAATTCAGGG - Intergenic
1041292290 8:56319424-56319446 TACAAACAAGAGTGAATGTACGG + Intronic
1041716322 8:60935659-60935681 CTCATGCAAGAAGGAATTCAAGG - Intergenic
1041742228 8:61168059-61168081 CTCTCACAAGAAAGAATTCAGGG - Intronic
1041773462 8:61497670-61497692 CTCATGCAAGAAAGAATTCAGGG + Intronic
1041774480 8:61509210-61509232 CTCAAACAAGAAAGAATTCAGGG + Intronic
1042876071 8:73440959-73440981 TTGAGACAGGAGTGAATTCAGGG - Intronic
1043870962 8:85431869-85431891 CTCATGCAAGAGAGAATTCAGGG - Intronic
1044949587 8:97422651-97422673 CTTACACAAGAAAGAATTCAGGG - Intergenic
1044986857 8:97763486-97763508 CTCACACAAGAAAGAATTCAAGG - Intergenic
1045228647 8:100277659-100277681 TTCAAACAGGACTGAATTAAAGG + Intronic
1045253140 8:100497812-100497834 CTCACACAAGAAAGAATTCGAGG + Intergenic
1045428091 8:102087160-102087182 CTCACACAAGAAAGAATTCAGGG - Intronic
1045428627 8:102092415-102092437 CTCACACAAGAAAGAGTTCAGGG - Intronic
1045624600 8:104028841-104028863 CTCAAACAAGAAAGAATTCAAGG + Intronic
1045688594 8:104737189-104737211 CTCGTACAAGAAAGAATTCAAGG - Intronic
1046184414 8:110694081-110694103 CCTATACAAGAATGAATTCAGGG + Intergenic
1046511583 8:115210958-115210980 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1046920118 8:119718970-119718992 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1047112795 8:121809492-121809514 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1047390856 8:124450072-124450094 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1047417095 8:124673587-124673609 AACAAACAAGAATGAAGTCATGG - Intronic
1047526724 8:125640400-125640422 CTCACACAAGAAAGAATTCAGGG - Intergenic
1048127223 8:131649242-131649264 CTCATACAAGAAGCAATTCAGGG + Intergenic
1048324434 8:133428301-133428323 CTCACACAAGAAAGAATTCAGGG - Intergenic
1048688591 8:136932967-136932989 CTCAGGCAAGAAAGAATTCAGGG + Intergenic
1050522179 9:6512287-6512309 CAGAAATAAAAGTGAATTCACGG - Intergenic
1050756874 9:9015631-9015653 CTCATGCAAGAAAGAATTCAGGG - Intronic
1051974477 9:22933081-22933103 CTCACACAAGAAAGAATTCAGGG + Intergenic
1052891433 9:33704095-33704117 CTCAAGCAAGAAAGAATTCAAGG - Intergenic
1053012775 9:34644467-34644489 CTCACACAAGAAAGAATTCAAGG - Intronic
1053060445 9:35026682-35026704 CTCACGCAAGAAAGAATTCAGGG - Intergenic
1053249047 9:36559231-36559253 CTCACACAAGAAAGAATTCAGGG + Intergenic
1054772047 9:69092192-69092214 CTCGCACAAGAAAGAATTCAGGG + Intronic
1055442665 9:76352017-76352039 CTCACACAAGAAAGAATTCAGGG + Intronic
1055451801 9:76437646-76437668 CTCACAAAAGAAAGAATTCAGGG - Intronic
1055567596 9:77584655-77584677 CTCATGCAAGAAAGAATTCAGGG + Intronic
1055832466 9:80397553-80397575 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1056681326 9:88721496-88721518 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1056892286 9:90506309-90506331 CTTACACAAGAAAGAATTCAGGG + Intergenic
1056974928 9:91244112-91244134 CCCAAACAAAAGTAAAATCAAGG + Intronic
1057138382 9:92711139-92711161 CTGAAACAAGAATGTGTTCAAGG - Intergenic
1057142605 9:92736658-92736680 CTCACGCAAGAAAGAATTCAAGG - Intronic
1057364041 9:94401771-94401793 CTCGAACAAGAAAGAATTCAGGG + Intronic
1057392629 9:94652421-94652443 CACACACAAGACTGAATTCATGG + Intergenic
1057659296 9:96986290-96986312 CTCGAACAAGAAAGAATTCAGGG - Intronic
1057988972 9:99747668-99747690 CTCACTCAAGAAAGAATTCAGGG - Intergenic
1058183726 9:101828964-101828986 ATCAAATAAGTCTGAATTCAAGG - Intergenic
1058449110 9:105079743-105079765 GTCAAACAACAATTAATTCAAGG - Intergenic
1059364938 9:113779554-113779576 CTTAAACAACAGATAATTCAAGG + Intergenic
1059400604 9:114067831-114067853 CTCAAACATGGGAGAATTCATGG + Intronic
1059593166 9:115686378-115686400 TTCAAAAAAGAGTCAATACAGGG + Intergenic
1060163344 9:121387488-121387510 CTTGCACAAGAGAGAATTCAGGG + Intergenic
1060266240 9:122112941-122112963 CTCACGCAAGAAAGAATTCAGGG + Intergenic
1060681303 9:125567660-125567682 CTCACGCAAGAAAGAATTCAGGG - Intronic
1060681906 9:125573591-125573613 CTCATGCAAGAAAGAATTCAGGG - Intronic
1060885767 9:127150881-127150903 ATCCATTAAGAGTGAATTCAGGG + Intronic
1203611073 Un_KI270749v1:4719-4741 CTCACACAGGAAAGAATTCAAGG - Intergenic
1185591028 X:1277292-1277314 CTCACGCAAGAAAGAATTCAGGG + Intronic
1185750230 X:2604999-2605021 CTCAAGCAAGAAAGAATTCGGGG - Intergenic
1185817247 X:3167757-3167779 CTCATACAAGAAAGAATTGAGGG + Intergenic
1185886192 X:3785402-3785424 CTCATGCAAGAAAGAATTCAGGG + Intergenic
1186120276 X:6353396-6353418 CTCAAACAAAAGCAAATTCACGG - Intergenic
1186165648 X:6823590-6823612 CTCACACAAGAAAGAATTCAGGG + Intergenic
1186438453 X:9564380-9564402 CTCAAACAAAGGTGTTTTCAGGG + Intronic
1186542572 X:10415747-10415769 CTTAAAAAAGAGTGAAATGATGG + Intergenic
1186883559 X:13890441-13890463 CTCATGCAAGAAAGAATTCAGGG - Intronic
1187220860 X:17324529-17324551 CTCACACAAGAAAGAATTCAGGG + Intergenic
1187376754 X:18762474-18762496 CTCGCACAAGAAAGAATTCAGGG + Intronic
1187682710 X:21783989-21784011 CTTAACCTAGAGTTAATTCAGGG - Intergenic
1188284389 X:28310543-28310565 CTCACACAAGAAAGAATTCAGGG - Intergenic
1188533335 X:31166636-31166658 CTTAAGCAACACTGAATTCAAGG + Intronic
1189419548 X:40844590-40844612 CTCACACAGGAAAGAATTCAGGG - Intergenic
1189433792 X:40973222-40973244 CTCACGCAAGAAAGAATTCAGGG - Intergenic
1189790554 X:44599668-44599690 CTTAAACAAAAATGAATTCTAGG - Intergenic
1190137917 X:47813938-47813960 CTCACACAAGAAAGAATTCAGGG + Intergenic
1190921059 X:54852656-54852678 CTCACACAAGAAAGAATTCAGGG + Intergenic
1191119345 X:56887383-56887405 CTCACACAGGAAAGAATTCAGGG - Intergenic
1191573134 X:62658670-62658692 CTTATACAAAAGTCAATTCAAGG - Intergenic
1191612923 X:63136218-63136240 CTCACACAAGAAAGAAATCAAGG - Intergenic
1191623374 X:63242708-63242730 CTCACACAAGAAAGAAATCAAGG + Intergenic
1191627564 X:63284575-63284597 CTCAGGCAAGAAAGAATTCAAGG + Intergenic
1192533480 X:71909625-71909647 CTGAGCCCAGAGTGAATTCAAGG + Intergenic
1192864532 X:75117136-75117158 CTCATGCAAGAAAGAATTCAGGG - Intronic
1193084437 X:77436739-77436761 CTGAACCAAGTGTGAATTTAGGG - Intergenic
1193903759 X:87217562-87217584 CTCGCACAAGAAAGAATTCAAGG + Intergenic
1194267084 X:91767606-91767628 CTCACACAAGAAAGAATTCAGGG + Intergenic
1194407925 X:93520779-93520801 CTTACACAAGAAAGAATTCAGGG + Intergenic
1194702186 X:97128049-97128071 CTCGCACAAGAAAGAATTCAGGG + Intronic
1195674414 X:107496970-107496992 ATCAAACAAGAATGAGGTCAAGG + Intergenic
1196401724 X:115323873-115323895 CTCATGCAAGAAAGAATTCAAGG + Intergenic
1196492868 X:116289486-116289508 CTCATGCAAGAAAGAATTCAGGG - Intergenic
1197636777 X:128923789-128923811 ATCAGAGAAGATTGAATTCAAGG + Intergenic
1198296129 X:135288992-135289014 CTCAAATATCAGTGAACTCAGGG - Intronic
1198497998 X:137213247-137213269 CTCACACAAGAAAGAGTTCAGGG - Intergenic
1199393635 X:147309403-147309425 CTCACGCAAGAATGAATTCAGGG - Intergenic
1199437210 X:147826065-147826087 CTCACAGAAGAAAGAATTCAAGG + Intergenic
1199572641 X:149282939-149282961 ATCAGACAAGACTGAATTCAAGG - Intergenic
1199782997 X:151080672-151080694 CACAAACAAATGTGAATTCATGG - Intergenic
1200584287 Y:4988545-4988567 CTCACACAAGAAAGAATTCAGGG + Intergenic
1200805992 Y:7434511-7434533 CTCGTGCAAGAGAGAATTCAGGG - Intergenic
1201390915 Y:13496473-13496495 CTCACGCAAGAAAGAATTCAGGG - Intergenic
1201436864 Y:13968519-13968541 CTTATACAAAAATGAATTCAAGG - Intergenic
1201470458 Y:14328366-14328388 CTCAGACAAGAGGGAATGAATGG - Intergenic
1202302100 Y:23427701-23427723 CTCACTCAAGAAAGAATTCAGGG + Intergenic
1202568711 Y:26242897-26242919 CTCACTCAAGAAAGAATTCAGGG - Intergenic