ID: 1169181686

View in Genome Browser
Species Human (GRCh38)
Location 20:3574585-3574607
Sequence CAAGATTACCAGAACTTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 233}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169181673_1169181686 30 Left 1169181673 20:3574532-3574554 CCACCCAGGCAACCCACTCAGGT 0: 1
1: 0
2: 1
3: 15
4: 183
Right 1169181686 20:3574585-3574607 CAAGATTACCAGAACTTAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 233
1169181674_1169181686 27 Left 1169181674 20:3574535-3574557 CCCAGGCAACCCACTCAGGTTCA No data
Right 1169181686 20:3574585-3574607 CAAGATTACCAGAACTTAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 233
1169181680_1169181686 17 Left 1169181680 20:3574545-3574567 CCACTCAGGTTCATTGGTGGGCT 0: 1
1: 0
2: 1
3: 10
4: 93
Right 1169181686 20:3574585-3574607 CAAGATTACCAGAACTTAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 233
1169181679_1169181686 18 Left 1169181679 20:3574544-3574566 CCCACTCAGGTTCATTGGTGGGC 0: 1
1: 0
2: 1
3: 15
4: 73
Right 1169181686 20:3574585-3574607 CAAGATTACCAGAACTTAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 233
1169181675_1169181686 26 Left 1169181675 20:3574536-3574558 CCAGGCAACCCACTCAGGTTCAT 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1169181686 20:3574585-3574607 CAAGATTACCAGAACTTAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169181686 Original CRISPR CAAGATTACCAGAACTTAGC AGG Intronic
900969687 1:5984370-5984392 CAAAAATACAAAAACTTAGCCGG + Intronic
901825792 1:11859980-11860002 TAAAATTACCAAAAATTAGCTGG + Intergenic
902430038 1:16355760-16355782 AAAAATTACTAGAACTGAGCCGG + Intronic
903621844 1:24703745-24703767 TAAAAATACAAGAACTTAGCCGG + Intergenic
905429751 1:37913093-37913115 TAAGAATACAAAAACTTAGCTGG + Intronic
905595385 1:39202126-39202148 TAAAATTACAAAAACTTAGCTGG - Intronic
905981989 1:42237211-42237233 CAAAAATACCAAAAATTAGCTGG + Intronic
906085390 1:43128679-43128701 CAAAAATACAAAAACTTAGCCGG - Intergenic
906241269 1:44243580-44243602 GAAGATTAGCAGAACTTTCCTGG + Intronic
906567273 1:46810187-46810209 CAAGATTACCCTATCTAAGCAGG + Intronic
908320322 1:62972314-62972336 CAAAAATACGAGAAATTAGCTGG - Intergenic
908863836 1:68522934-68522956 CAAAGTTACCAGAACATAGTAGG - Intergenic
908885736 1:68786358-68786380 CGTGAGCACCAGAACTTAGCTGG - Intergenic
909301818 1:74022198-74022220 TAAAAATACCAGAAATTAGCTGG + Intergenic
910395428 1:86789055-86789077 CAACATTACAAGAACTGACCAGG + Intergenic
911623630 1:100095367-100095389 CAAAATTACAAAAAATTAGCTGG + Intronic
912763605 1:112389542-112389564 GAAAATTACCAGAAATAAGCAGG - Intergenic
914877802 1:151525235-151525257 CAAAAATACAAAAACTTAGCTGG + Intronic
916232729 1:162556393-162556415 CAAAAATACAAAAACTTAGCTGG - Intergenic
917377874 1:174369349-174369371 CAAAATTACAAAAAATTAGCTGG - Intronic
917818850 1:178740015-178740037 CAAGAGTACCACAACTGAGGAGG - Intronic
918011257 1:180588865-180588887 TAAGATTACAAAAAATTAGCCGG - Intergenic
919304173 1:195808675-195808697 TAAAATTACCAAAAATTAGCTGG - Intergenic
919770076 1:201152550-201152572 CAGGAGTCCCAGAACTTAGGTGG + Intronic
921502805 1:215926766-215926788 CAAAAATACAAAAACTTAGCCGG - Intronic
1064664946 10:17641148-17641170 CAAAAATACAAAAACTTAGCTGG - Intergenic
1068029019 10:51684703-51684725 CAAAAATACAAAAACTTAGCTGG + Intronic
1068998042 10:63230611-63230633 TAAAATTACAAAAACTTAGCTGG + Intronic
1069025328 10:63533866-63533888 CAATAATACCAAAAATTAGCTGG - Intronic
1072561660 10:96581872-96581894 CAAGATTACCAGAAGTACACTGG + Intronic
1072830852 10:98656921-98656943 CAAAAATACCAAAAATTAGCCGG - Intronic
1073418136 10:103401902-103401924 CAAAAATACAAAAACTTAGCTGG - Intronic
1073783946 10:106867444-106867466 TAAAAATACCAGAAATTAGCCGG - Intronic
1076332038 10:129677383-129677405 CAAGGTTACCATAAATCAGCAGG + Intronic
1078241176 11:9531873-9531895 CAAAAATACCAAAAATTAGCCGG - Intergenic
1081436182 11:43029955-43029977 TGAGATTACCACAACTTAGCTGG - Intergenic
1083085871 11:60144606-60144628 CATGATTTCCAGAAATTACCAGG - Intergenic
1083438438 11:62659542-62659564 AAAGATTAAAAAAACTTAGCCGG + Intronic
1084240431 11:67816029-67816051 CAAAATTACAAAAAATTAGCTGG + Intergenic
1085285484 11:75357261-75357283 TAAGAATACCAAAAATTAGCTGG - Intergenic
1085687029 11:78632882-78632904 AAAGAATACCAGAATTCAGCAGG + Intergenic
1085926659 11:81032175-81032197 CAAGTTTACCAGAACAAATCAGG - Intergenic
1086980621 11:93194148-93194170 CAAGTTTACCAGAATATAGACGG + Intronic
1087828422 11:102792767-102792789 AGAGATTACCAGAAATTAGATGG - Intronic
1088317658 11:108523709-108523731 CAAAAATACAAAAACTTAGCAGG + Intronic
1088401830 11:109429798-109429820 CAAGATTAGCAGAATTGAGGTGG - Intergenic
1088688137 11:112302113-112302135 CAAAATTAACAGAACTTTGTAGG + Intergenic
1089212179 11:116812575-116812597 CATGATGACTAGAACTTAGTAGG - Intergenic
1089231164 11:116978054-116978076 TAAAATTACAAAAACTTAGCTGG + Intronic
1089894593 11:121917299-121917321 CAACATTACTGGATCTTAGCTGG - Intergenic
1090216432 11:124969668-124969690 GTAGATTACAAGAATTTAGCAGG - Intronic
1093453560 12:19341891-19341913 CAAAAATACAAAAACTTAGCTGG - Intronic
1093683864 12:22034253-22034275 CAAAAATACAAAAACTTAGCTGG - Intergenic
1095331287 12:40967556-40967578 AAAGCTTTACAGAACTTAGCAGG + Intronic
1096274411 12:50193824-50193846 CAAAAGTACCAAAACTTAGCTGG - Intronic
1098314453 12:69178372-69178394 CAAAAATACCAAAAATTAGCTGG - Intergenic
1100638589 12:96459471-96459493 TAAAAATACCAGAAATTAGCCGG - Intergenic
1102795015 12:115681695-115681717 CAAAATTACAAAAAATTAGCTGG + Intergenic
1103091408 12:118100688-118100710 CAAAAATACAAAAACTTAGCGGG - Intronic
1103455204 12:121059962-121059984 CAAAAATACCAAAAATTAGCCGG - Intergenic
1106663561 13:31827423-31827445 CAACATTCCCAGAACTTGGCAGG - Intergenic
1106910964 13:34463287-34463309 CAAAAATACAAAAACTTAGCTGG + Intergenic
1108614833 13:52122061-52122083 CAAAAATACCATAATTTAGCTGG - Intronic
1109342730 13:61081876-61081898 CAAGATAATCAGAACTAAGTGGG - Intergenic
1115505751 14:34092786-34092808 TAAGAATACAAGAAATTAGCCGG - Intronic
1117308099 14:54496117-54496139 CAAAAATACAAAAACTTAGCTGG - Intergenic
1119587448 14:75849942-75849964 CAAAAATACAAGAAATTAGCTGG + Intronic
1122039905 14:98979725-98979747 TAAGAATACAAAAACTTAGCTGG + Intergenic
1124856084 15:33390729-33390751 CTAGATTCCCAGAACTAAGCAGG - Intronic
1125107783 15:35994091-35994113 CAAGATGACAAGATCTCAGCAGG - Intergenic
1125308791 15:38355115-38355137 CTAAAATACCAAAACTTAGCTGG - Exonic
1127591878 15:60433247-60433269 TAAAATTACAAAAACTTAGCCGG - Intronic
1129588915 15:76897543-76897565 CAAAAATACAAAAACTTAGCTGG + Intronic
1130225265 15:82052411-82052433 AAAAATTACAAAAACTTAGCTGG - Intergenic
1132955754 16:2592511-2592533 TAAAATTACCAAAAATTAGCTGG + Intronic
1133731320 16:8580850-8580872 CAAGAATACAAAAAATTAGCCGG - Intronic
1133802752 16:9097401-9097423 CAAAAATACAAAAACTTAGCTGG - Intronic
1136244020 16:28963018-28963040 CAAAAATACAAAAACTTAGCTGG + Intronic
1137525734 16:49234719-49234741 CAAAAATACCAGAAATTAGGTGG + Intergenic
1137747642 16:50834860-50834882 CAAGTGGACCAGAACTCAGCGGG + Intergenic
1138826724 16:60329798-60329820 TAAAATTACCAAAACTTAGCTGG - Intergenic
1139578036 16:67854784-67854806 CAAGATTCCAAAAAATTAGCAGG + Intronic
1140087135 16:71807512-71807534 CGAGATTACGAGTACTTAGAGGG + Intronic
1141866814 16:86755911-86755933 CAAAAATACAAAAACTTAGCCGG + Intergenic
1142702430 17:1671687-1671709 CAAAAATACAAAAACTTAGCCGG + Intronic
1144323101 17:14150109-14150131 CAACAATACAAAAACTTAGCCGG + Intronic
1146026991 17:29330343-29330365 TAAAAATACAAGAACTTAGCCGG - Intergenic
1147132257 17:38416340-38416362 CAAAATTACAAAAAATTAGCTGG - Intergenic
1148260614 17:46179900-46179922 TAAAATTACCAAAAATTAGCCGG + Intronic
1148622807 17:49047078-49047100 GAAGATATCCAGATCTTAGCAGG + Intronic
1148879945 17:50718143-50718165 CAAAAATACAAAAACTTAGCCGG + Intergenic
1149011833 17:51864974-51864996 CAAGAATACCAGTACTAAGAAGG + Intronic
1150337297 17:64339987-64340009 CAAAAATACAAAAACTTAGCTGG + Intronic
1152402654 17:80077359-80077381 CAAAAATACCAAAAATTAGCTGG + Intronic
1153029280 18:698780-698802 CAAAAATACAAGAAATTAGCTGG - Intronic
1153638630 18:7135384-7135406 CAAATTTACCAGCACTTATCAGG + Intergenic
1155263627 18:24070439-24070461 AAAGAGTACCAGAGCTTATCTGG + Intronic
1157342989 18:46796082-46796104 CAAAAATACAAAAACTTAGCCGG + Intergenic
1161658980 19:5534329-5534351 AAAGAATACCAAAAATTAGCCGG - Intergenic
1163121696 19:15222322-15222344 CAAAATTACAAAAAATTAGCCGG - Intergenic
1163406280 19:17125137-17125159 CAAAAATACAAAAACTTAGCCGG + Intronic
1166835175 19:45663241-45663263 TAAGAATACAAAAACTTAGCTGG + Intergenic
1167402326 19:49281053-49281075 CAAAAATACCAAAAGTTAGCTGG + Intergenic
1167831030 19:52022916-52022938 CAAGAGTACAAAAAATTAGCCGG + Intronic
1167930796 19:52862870-52862892 CAAAATTACAACAAATTAGCTGG + Intergenic
1167957477 19:53078076-53078098 CAAAAATACAAAAACTTAGCTGG + Intronic
1168050341 19:53825059-53825081 CAAAACTACAAAAACTTAGCTGG - Intergenic
1168231378 19:55034392-55034414 TAAAAATACCAGAAATTAGCTGG + Intronic
925782749 2:7398011-7398033 TAAAAATACCAAAACTTAGCTGG - Intergenic
925809038 2:7680325-7680347 CAAAAATACAAAAACTTAGCTGG - Intergenic
926318349 2:11728544-11728566 CAAAAATACAAAAACTTAGCTGG - Intronic
926420576 2:12692794-12692816 AAAAATTACCAAAAATTAGCTGG - Intergenic
926713417 2:15902597-15902619 TAAGAATACAAGAAATTAGCAGG + Intergenic
928240818 2:29584125-29584147 AAAAATTACCAGAACTGAGGGGG + Intronic
930654656 2:53995970-53995992 CAAAATTACAAAAAATTAGCTGG + Intronic
930988603 2:57621912-57621934 CAAGATTACCAGAACTTTTTAGG + Intergenic
931353936 2:61517421-61517443 CAAAATTAGAAAAACTTAGCTGG + Intronic
933887988 2:86738203-86738225 CGGGAGTACCAGAACTGAGCAGG - Intronic
933922190 2:87058502-87058524 CGGGAGTACCAGAACTGAGCAGG + Intergenic
937497509 2:122437203-122437225 TAAAATTACAAAAACTTAGCTGG - Intergenic
937995934 2:127695113-127695135 CAAAAATACAAGAAATTAGCCGG - Intergenic
938112198 2:128576221-128576243 TAAAATTACCAAAAATTAGCTGG - Intergenic
939960182 2:148559422-148559444 CAAAAATACCAAAAATTAGCTGG + Intergenic
943155046 2:184165367-184165389 GAAAATTACCAGTACTTGGCAGG - Intergenic
947723910 2:232385604-232385626 TAAAAATACCAAAACTTAGCTGG - Intergenic
947753550 2:232545143-232545165 CAAAAATACCAAAAATTAGCTGG + Intronic
948214473 2:236218500-236218522 GAAGAATACCAGAAATTGGCCGG + Intronic
1169181686 20:3574585-3574607 CAAGATTACCAGAACTTAGCAGG + Intronic
1173346167 20:42202129-42202151 CTAAATTACAAAAACTTAGCTGG - Intronic
1174229443 20:49032751-49032773 CAAAAATACAAAAACTTAGCTGG - Intronic
1174437928 20:50524736-50524758 CAAAAATACCAAAAATTAGCTGG - Intronic
1175365872 20:58455804-58455826 AAAAATTACCAAAACTTAGGTGG - Intergenic
1176114756 20:63427058-63427080 CAAAAATAACAAAACTTAGCCGG + Intronic
1177627220 21:23678244-23678266 GAAGATTAATATAACTTAGCAGG - Intergenic
1180585153 22:16881843-16881865 CAAAAATACCAAAAATTAGCCGG + Intergenic
1182042630 22:27250282-27250304 AAAGATGACCAGCACTTAGTAGG - Intergenic
1182217465 22:28731039-28731061 CAAGAATACAAAAAGTTAGCTGG + Intronic
1182644194 22:31794722-31794744 AAAAAATACCATAACTTAGCTGG + Intronic
1182809426 22:33103269-33103291 CAAAATTACAAAAAATTAGCCGG + Intergenic
949178961 3:1102943-1102965 CAAAAATACAAGAAATTAGCCGG + Intronic
950986294 3:17371873-17371895 CAAAACTACAAAAACTTAGCTGG + Intronic
952662258 3:35865889-35865911 CAAAATTACAAAAACTTAGCGGG + Intergenic
954559440 3:51543993-51544015 TAAAAATACCAAAACTTAGCAGG - Intronic
955332496 3:58059160-58059182 AAAGACTACCAGATGTTAGCTGG - Intronic
956535473 3:70271247-70271269 CAAGATGACCAGGACTAGGCAGG + Intergenic
957131315 3:76225551-76225573 CAAAAATACAAAAACTTAGCTGG + Intronic
957512209 3:81203729-81203751 AAAGATTACAAAAAATTAGCCGG - Intergenic
959647274 3:108717472-108717494 CAAAAATACCAAAAATTAGCAGG - Intergenic
960399138 3:117174442-117174464 TAAAATTACAAGAAATTAGCCGG + Intergenic
963869601 3:150401014-150401036 TAAAAATACCAAAACTTAGCTGG - Intergenic
965589644 3:170350338-170350360 AAAAATTACCAAAAATTAGCTGG + Intergenic
965648638 3:170909952-170909974 CAAAAATACGAAAACTTAGCTGG + Intergenic
967309555 3:188093278-188093300 CAAAAATACAAAAACTTAGCTGG - Intergenic
971323228 4:25622314-25622336 CAAAAATACAAGAAATTAGCCGG - Intergenic
971505860 4:27365807-27365829 CAAAAATACAAAAACTTAGCTGG - Intergenic
971791484 4:31175196-31175218 CAAGAGTACAAAAAATTAGCTGG - Intergenic
972872754 4:43320533-43320555 CAATGTTACCAGAGCTCAGCAGG - Intergenic
973256244 4:48116568-48116590 GAAGGTTACCAGAACCTAGAAGG + Intronic
973744745 4:53952339-53952361 CAAGATTACAAAAAATTAGCTGG - Intronic
974604546 4:64134398-64134420 TAAAATTACCAAAAATTAGCCGG - Intergenic
974842891 4:67318564-67318586 CAAAAATACAAAAACTTAGCTGG - Intergenic
974953668 4:68612614-68612636 CAAGATAATCAGAACTTAAATGG + Intronic
976989817 4:91352406-91352428 TAAAATTACAAAAACTTAGCTGG - Intronic
977091589 4:92683135-92683157 TAAAAATACCAAAACTTAGCTGG + Intronic
977778484 4:100951839-100951861 CATAATTACTAGAACTGAGCAGG + Intergenic
980881260 4:138712131-138712153 AAAAATTACCAAAAATTAGCTGG - Intergenic
981604079 4:146523400-146523422 CAAGATAAAAAGAACTTAACAGG + Intergenic
982012540 4:151120056-151120078 AAAAAATACCAGAAATTAGCTGG + Intronic
982264688 4:153527432-153527454 AAAGAATACAAAAACTTAGCCGG - Intronic
982619168 4:157681220-157681242 CAAAAATACCAAAAATTAGCTGG + Intergenic
983527151 4:168770896-168770918 TAAAAATACAAGAACTTAGCTGG + Intronic
983577744 4:169276604-169276626 CAAAAATACAAAAACTTAGCTGG - Intergenic
987845876 5:23284629-23284651 CAAGATTGCCAGAATTAACCAGG - Intergenic
987901340 5:24015798-24015820 CAAGAATACAAAAAATTAGCCGG + Intronic
987970831 5:24941601-24941623 CAAGATTACCAGATATTTTCGGG + Intergenic
991070402 5:62472687-62472709 CAAAAATACAAAAACTTAGCTGG - Intronic
993166881 5:84367619-84367641 CAAGAATACAAAAAATTAGCTGG + Intronic
993527061 5:88977821-88977843 CAAGAGTACCAGAAGGTAGAGGG + Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
998190999 5:140024414-140024436 AAAAATTACAAAAACTTAGCCGG - Intronic
999878215 5:155832059-155832081 AAAAATAACCAGAACTAAGCTGG - Intergenic
1000291922 5:159878604-159878626 CATGATTCCCAAAACATAGCAGG + Intergenic
1000328008 5:160186984-160187006 CAAAAATACAAAAACTTAGCTGG + Intergenic
1004587233 6:17014381-17014403 CAAAAATACAAAAACTTAGCTGG + Intergenic
1005685387 6:28248665-28248687 CAAAATTACAAAAAATTAGCAGG + Intronic
1005937180 6:30532306-30532328 CAAAATTACAAAAATTTAGCTGG - Intergenic
1007964326 6:45989676-45989698 AAAATTTACCAGAAGTTAGCTGG + Intronic
1009900103 6:69799700-69799722 GAAGATTACAAGACCTCAGCAGG - Intergenic
1010064905 6:71670989-71671011 CAATATTACAGAAACTTAGCTGG + Intergenic
1011886157 6:92098231-92098253 CAAAAATACCAAAAATTAGCTGG - Intergenic
1015528851 6:134200740-134200762 CAAGAATACAAGAAATTAGCTGG + Intronic
1016342332 6:143076831-143076853 CAAAAATACAAGAAATTAGCCGG - Intronic
1017334160 6:153235813-153235835 CAAAAATACCAAAAATTAGCTGG + Intergenic
1019698956 7:2463493-2463515 CAAAAATACAAGAAATTAGCCGG + Intergenic
1019823738 7:3266441-3266463 CAAGATCCCTAGCACTTAGCAGG + Intergenic
1020197911 7:6056430-6056452 CAAAAATACAAGAAATTAGCTGG + Intronic
1021758324 7:23877556-23877578 CACAATTACCAGAATTAAGCTGG - Intergenic
1022182369 7:27933766-27933788 CAAGCTTGCCAGAACTCAGCAGG - Intronic
1024463884 7:49688535-49688557 AAACATTACCTAAACTTAGCTGG + Intergenic
1030204464 7:106939456-106939478 CAAAAGTACCAAAAATTAGCTGG - Intergenic
1030603264 7:111612636-111612658 CAAAAATACAAAAACTTAGCCGG + Intergenic
1032980692 7:137278777-137278799 TAAAATTACAAAAACTTAGCCGG + Intronic
1035697128 8:1606843-1606865 CAAAAATACAAAAACTTAGCTGG - Intronic
1036475132 8:9086251-9086273 CAAAAATACCAAAAATTAGCTGG + Intronic
1036528876 8:9562756-9562778 CAACATTAACAGCTCTTAGCAGG - Intronic
1037105015 8:15096236-15096258 AAAAATTACCAAAAGTTAGCTGG - Intronic
1038564532 8:28608700-28608722 CAAAAATACAAAAACTTAGCCGG + Intronic
1040634100 8:49252420-49252442 CAATATTCCCAGAACCCAGCTGG - Intergenic
1042982370 8:74544738-74544760 TAACATTACCAGAAATAAGCTGG - Intergenic
1043796937 8:84554617-84554639 CAAGAATCCCAGAAATTACCAGG - Intronic
1044384177 8:91567576-91567598 CAAGGTTACCAGCACCTTGCAGG - Intergenic
1045371290 8:101525806-101525828 AAAAATTACCAAAAATTAGCTGG + Intronic
1045414911 8:101956364-101956386 CAAGTTTACCCAAACATAGCCGG + Intronic
1047785251 8:128148038-128148060 CAACATTGCCAGAAATTAGTGGG + Intergenic
1049934637 9:489689-489711 TAAGATGCCCAGCACTTAGCAGG + Intronic
1052481214 9:29028815-29028837 CAAGGCTATCAGAACTTAGATGG + Intergenic
1053071980 9:35107159-35107181 CAAAAATACCAAAAATTAGCTGG + Intronic
1053438276 9:38092160-38092182 CAAAAATACAAGAATTTAGCTGG - Intergenic
1053569688 9:39291259-39291281 CAAAAATACAAAAACTTAGCCGG - Intergenic
1053835651 9:42132294-42132316 CAAAAATACAAAAACTTAGCCGG - Intergenic
1054091319 9:60850264-60850286 CAAAAATACAAAAACTTAGCCGG - Intergenic
1054112734 9:61125834-61125856 CAAAAATACAAAAACTTAGCCGG - Intergenic
1054127460 9:61327754-61327776 CAAAAATACAAAAACTTAGCCGG + Intergenic
1054594980 9:67056312-67056334 CAAAAATACAAAAACTTAGCCGG + Intergenic
1055043883 9:71905282-71905304 TAAAAATACCAAAACTTAGCCGG - Intronic
1056414838 9:86366298-86366320 AAAGAATCCCAGAACTAAGCGGG - Intergenic
1056970674 9:91199266-91199288 TAAAAATACCAGAAATTAGCTGG - Intergenic
1057655701 9:96949973-96949995 CAAAATTACAAAAAATTAGCCGG + Intronic
1060378985 9:123147513-123147535 CAAAAATACAAAAACTTAGCAGG + Intronic
1061100407 9:128487623-128487645 TAAAAATACAAGAACTTAGCCGG + Intronic
1061638496 9:131931081-131931103 CAAAAATACAAAAACTTAGCTGG + Intronic
1187526454 X:20059473-20059495 CAGGAGAACCAGAACTTGGCAGG - Intronic
1188910254 X:35838957-35838979 AAATATTACCAGATCTTAGCTGG + Intergenic
1189266509 X:39720742-39720764 CAAGATTACCAGATCTTGGAGGG + Intergenic
1190252970 X:48741259-48741281 CAAAATTACAAAAAATTAGCCGG - Intergenic
1190648476 X:52545016-52545038 CAAAAATACAAAAACTTAGCTGG - Intergenic
1194177505 X:90668420-90668442 CAAAAATACCAGAAGCTAGCAGG + Intergenic
1197280828 X:124533974-124533996 CAAGATAACTTGAACTTAGATGG + Intronic
1198258805 X:134948175-134948197 TAAAATTACAAAAACTTAGCTGG - Intergenic
1198370192 X:135982633-135982655 CAAAATTAACAGAAATTAGCCGG - Intergenic
1198859523 X:141054792-141054814 CAAAAATACAAAAACTTAGCTGG + Intergenic
1198903171 X:141532598-141532620 CAAAAATACAAAAACTTAGCTGG - Intergenic
1199642268 X:149873951-149873973 CAAAAATACAAAAACTTAGCCGG + Intergenic
1202282300 Y:23202424-23202446 CAAAAATACCAAAAATTAGCTGG + Intergenic
1202283591 Y:23216095-23216117 CAAAAATACCAAAAATTAGCTGG - Intergenic
1202433971 Y:24816809-24816831 CAAAAATACCAAAAATTAGCTGG + Intergenic
1202435268 Y:24830481-24830503 CAAAAATACCAAAAATTAGCTGG - Intergenic