ID: 1169187899

View in Genome Browser
Species Human (GRCh38)
Location 20:3634250-3634272
Sequence GCAACGGTGGGAGCTGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169187888_1169187899 27 Left 1169187888 20:3634200-3634222 CCCGGAGGTGGCATGTGGGAGCT 0: 1
1: 1
2: 1
3: 25
4: 286
Right 1169187899 20:3634250-3634272 GCAACGGTGGGAGCTGATTCTGG 0: 1
1: 0
2: 0
3: 6
4: 72
1169187894_1169187899 -6 Left 1169187894 20:3634233-3634255 CCTGGCCTGAGGTGTGGGCAACG 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1169187899 20:3634250-3634272 GCAACGGTGGGAGCTGATTCTGG 0: 1
1: 0
2: 0
3: 6
4: 72
1169187889_1169187899 26 Left 1169187889 20:3634201-3634223 CCGGAGGTGGCATGTGGGAGCTG 0: 1
1: 0
2: 5
3: 37
4: 268
Right 1169187899 20:3634250-3634272 GCAACGGTGGGAGCTGATTCTGG 0: 1
1: 0
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169187899 Original CRISPR GCAACGGTGGGAGCTGATTC TGG Intronic
903019279 1:20382643-20382665 GCCAGTGTGGGACCTGATTCTGG - Intergenic
904642056 1:31938365-31938387 GCGGCGGCGGGAGCTGGTTCCGG - Exonic
906420122 1:45658828-45658850 GCTACTCTGGGAGCTGAGTCAGG + Intronic
908264115 1:62361587-62361609 GTAACAGTGGGAGCTGGTCCAGG + Intergenic
914992311 1:152509643-152509665 GCAAGGGTGGGAACTGATGCTGG + Intergenic
919771190 1:201159964-201159986 GCAGTGGTGGGAGCTGAACCAGG - Intronic
920359064 1:205399917-205399939 ACCACAGTGGAAGCTGATTCAGG + Intronic
921189358 1:212696083-212696105 TCAATGTTGGGAGCTGATGCTGG + Intronic
924553781 1:245101853-245101875 TGAACAGTGGGAGCTGCTTCAGG + Intronic
1062985096 10:1761242-1761264 GCAATGGTTGAGGCTGATTCAGG + Intergenic
1064369029 10:14735001-14735023 GCAAGTGTGGCAGCTGATGCAGG - Intronic
1068477342 10:57545636-57545658 GCAAAGGTGGGAGCAAATACGGG + Intergenic
1069799237 10:71072022-71072044 GAAACTGTGTGAGCTGATCCAGG + Intergenic
1082295452 11:50436625-50436647 GCATCGTTGGGAGCTCATTGAGG + Intergenic
1084156740 11:67317447-67317469 GTGACGGTGGGAGCTGGTTCCGG - Intergenic
1096768957 12:53920294-53920316 GCAAATGTGGGAGCTGATCCTGG - Intergenic
1100688893 12:97017629-97017651 GCAAAGGTGGAAGGTGATGCAGG + Intergenic
1108376713 13:49820824-49820846 GCAAAGGTGGGGGCGGAGTCAGG + Intergenic
1110404365 13:75133361-75133383 ACAAAGGTGGGAGCAGATTAAGG + Intergenic
1121261591 14:92570177-92570199 GCCAGGGTGGGAGCTGAGGCTGG - Intronic
1121915431 14:97833524-97833546 GCAATGCTGGGTGCTGATGCTGG - Intergenic
1124256517 15:28147004-28147026 GCTCTGTTGGGAGCTGATTCTGG + Intronic
1124567713 15:30832089-30832111 GCTCTGTTGGGAGCTGATTCTGG - Intergenic
1126181892 15:45793549-45793571 GCAGTGGTGGAAGCTGAATCAGG + Intergenic
1132662684 16:1068647-1068669 GCAGCCGTGGGCGCTGACTCAGG - Intergenic
1132680659 16:1140201-1140223 GCAGGGGTGGCAGCTCATTCCGG + Intergenic
1133788282 16:8989663-8989685 GGCAGGATGGGAGCTGATTCAGG + Intergenic
1134011245 16:10854741-10854763 GTAAAGGTGGAAGATGATTCCGG + Intergenic
1135484340 16:22850941-22850963 GCATGGCTGGGAGCTGCTTCTGG + Intronic
1142973338 17:3628009-3628031 GCAATCGTAGGAGCTGATGCAGG - Intronic
1148702784 17:49600323-49600345 GCAACAGTGGCTGCTGCTTCTGG + Exonic
1149596673 17:57868364-57868386 GCAAGGGTGGGAGCTGAGGAGGG + Intronic
1152309994 17:79544281-79544303 GCATCCTTGGGGGCTGATTCTGG - Intergenic
1157764590 18:50286883-50286905 GCCACGGTGGGGGCTGCTTAAGG - Intronic
1158932981 18:62339195-62339217 GAAAAGGTGGGGGCTGCTTCGGG - Intronic
1161979339 19:7622462-7622484 GGAAAGGTTGGAGCTGGTTCTGG + Intronic
1163702063 19:18790982-18791004 GCAACGGTGGGAGTTGGTGGTGG - Intronic
1165772042 19:38385748-38385770 GCCACGGTGGGAGCTGGAGCCGG + Exonic
1166052689 19:40269869-40269891 GAAGGGGTGGGAGCTGACTCAGG - Intronic
928155662 2:28874073-28874095 GCTACGCTGGAAGCTGAATCAGG - Intergenic
935496842 2:103792641-103792663 GCAAAGGTGGGATTTGATTTGGG - Intergenic
936149627 2:110008128-110008150 GAAAGGGTGGCAGCTGATGCGGG - Intergenic
936195051 2:110363241-110363263 GAAAGGGTGGCAGCTGATGCGGG + Intergenic
937988832 2:127651103-127651125 GAAACGGTCGGCGCTGATGCAGG - Exonic
940703653 2:157077169-157077191 ACAACGGTGAGAGGTGAATCTGG + Intergenic
942185455 2:173420945-173420967 GTAAAGGTGGGAACTTATTCTGG - Intergenic
947945965 2:234102565-234102587 GCAACAGGGAGAGCTGATGCTGG - Intergenic
1169187899 20:3634250-3634272 GCAACGGTGGGAGCTGATTCTGG + Intronic
1173953119 20:47008726-47008748 GCAAGGGTGGGATGTGAATCTGG - Intronic
1178559928 21:33629133-33629155 GCTGAGGTGGGAGCTGATGCTGG + Intronic
1179502332 21:41818054-41818076 GCAGGGGTGGGGGCTTATTCAGG - Intronic
1182740887 22:32566657-32566679 GGAGTGGTGGGAGCTGATTCAGG + Intronic
960715374 3:120569720-120569742 GAATCCCTGGGAGCTGATTCAGG - Intergenic
961521240 3:127468475-127468497 GCACAGGTGGGAGCTGAATGTGG + Intergenic
961580374 3:127875829-127875851 GCAAGCTGGGGAGCTGATTCAGG + Intergenic
962856812 3:139354219-139354241 CCAACAGTGGGAACTGAGTCTGG - Intronic
967121027 3:186383152-186383174 GTAATTCTGGGAGCTGATTCTGG + Intergenic
967883035 3:194315040-194315062 GCAGCGATGGGAGTTGATTCTGG - Intergenic
969344552 4:6563008-6563030 GCGCCGGTGGGTGCTGAGTCAGG - Intronic
969518497 4:7662044-7662066 GCAGGGCTGGGAGCTGATGCCGG - Intronic
972158725 4:36197807-36197829 GCAGCTGTGGAAGCTGCTTCTGG - Intronic
978714027 4:111820331-111820353 GCAACCGTGGGATCAGGTTCTGG - Intergenic
990563362 5:57005403-57005425 GCAAGGGTGTGAGCTGACTCTGG - Intergenic
1005669680 6:28092621-28092643 GTAAGGCTGTGAGCTGATTCTGG + Intergenic
1006257586 6:32843932-32843954 GCAACCGGGAGAGCCGATTCCGG + Exonic
1014308835 6:119773125-119773147 CCAACTGAGGGAGCTGATTGTGG - Intergenic
1021266942 7:18536342-18536364 GTTTAGGTGGGAGCTGATTCGGG - Intronic
1024510951 7:50204441-50204463 GCAAGGATTGGGGCTGATTCTGG - Intergenic
1035035843 7:155893229-155893251 GCAGCTGTGGGGGCTCATTCAGG - Intergenic
1035433231 7:158838147-158838169 GGAACGGTGCGAAATGATTCAGG + Intergenic
1036652521 8:10654461-10654483 GCTGGGGTGGGAGCAGATTCTGG - Intronic
1040530283 8:48261047-48261069 GCAGCGCTGGGAGCTGAGCCTGG + Intergenic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1059275455 9:113092850-113092872 GCTACTGTGGGAGCTGAGGCAGG + Intergenic
1059384154 9:113950932-113950954 GCCTCGGTGGGAGCTGAGGCTGG + Intronic
1060822633 9:126670207-126670229 GCAGCTGTGGGGGCTGTTTCAGG - Intronic
1192767981 X:74162010-74162032 GCAACTGTAGGAGCAGGTTCAGG - Intergenic
1198300906 X:135333490-135333512 GCAACAGTGGGTGCTGGTTGTGG - Intronic
1198605454 X:138332320-138332342 GCAAATGTGGTAGATGATTCTGG + Intergenic