ID: 1169189751

View in Genome Browser
Species Human (GRCh38)
Location 20:3650754-3650776
Sequence CAGAATTAGTTCAACGAAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169189751_1169189754 27 Left 1169189751 20:3650754-3650776 CCTGTTTCGTTGAACTAATTCTG 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1169189754 20:3650804-3650826 TATTTACGATTTCGTTTGTTTGG 0: 1
1: 0
2: 0
3: 9
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169189751 Original CRISPR CAGAATTAGTTCAACGAAAC AGG (reversed) Exonic
912981821 1:114380980-114381002 TAGAAATAGTTTAACAAAACAGG - Intergenic
919489334 1:198186517-198186539 CAGAAGTAGCTCAAAGATACAGG + Intronic
920652209 1:207846553-207846575 CAGAATAAGTACAATGAAAAAGG + Intergenic
924015538 1:239717265-239717287 CATAATTAAGTCAACAAAACTGG - Intronic
924375136 1:243399808-243399830 CAGAGGTAGTTCCAAGAAACGGG - Intronic
1065533185 10:26693508-26693530 CACAATTAGCTAAAGGAAACAGG + Intergenic
1068049863 10:51936053-51936075 CAATATTTGTTCAAGGAAACTGG + Intronic
1070343406 10:75519267-75519289 CAATATTAGATCAACGAGACAGG - Intronic
1073541972 10:104322226-104322248 CAGAATTACTACAACCAACCAGG + Intronic
1079175643 11:18137691-18137713 CAGAATTAGCACCACTAAACAGG - Exonic
1085588395 11:77733235-77733257 TAGAATTAGTAAAACGAAAATGG - Intronic
1087686577 11:101272454-101272476 CAGCAGTAGTCCAACAAAACAGG + Intergenic
1092570605 12:9717112-9717134 GAAAATTAGTTCAACAAGACTGG + Intronic
1093872730 12:24311466-24311488 CAAAATTAGTTCAACAAACTTGG - Intergenic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1095896482 12:47285190-47285212 CAGAATTTGTTCTAGGAAAAAGG + Intergenic
1097505993 12:60471013-60471035 TAGAATTAATTCAGCAAAACAGG - Intergenic
1101172447 12:102112485-102112507 CATAATAAGTTCAATGAAAATGG + Intronic
1105886011 13:24642149-24642171 CACAATTAGTTCTAGGAAAGAGG + Intergenic
1106631130 13:31474854-31474876 TGGAATAAGTTTAACGAAACAGG - Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1108671408 13:52692978-52693000 CAGCATTTGTACAACGGAACTGG - Intronic
1110572626 13:77022939-77022961 CAAAATTAGTTTAATAAAACAGG + Intronic
1111594257 13:90390364-90390386 GAGAATTTGTGCAACGAAGCTGG - Intergenic
1117649198 14:57884824-57884846 CATAATTATTTCCATGAAACTGG - Intronic
1117942420 14:60982047-60982069 ATGAATTAGTTCTACCAAACTGG - Intronic
1119497720 14:75095005-75095027 AAGAAATAGTTCACCAAAACAGG - Intronic
1119985825 14:79136288-79136310 CAGAAATTTTTCAACCAAACAGG + Intronic
1124428774 15:29588036-29588058 CACAATTAGTTAAAAGATACAGG + Intergenic
1129981117 15:79872281-79872303 CAGAATTAGATCAGAGAAAATGG - Intronic
1134124338 16:11606015-11606037 CACAATAAGTTTAACGAAAAAGG - Intronic
1137994672 16:53197620-53197642 CAGAATGAGTTGAACTAGACAGG - Intronic
1139001747 16:62519216-62519238 CAATATTAGATCAACGAGACAGG + Intergenic
1139616014 16:68092605-68092627 CAAAATTAGTACATCGAAGCTGG + Intronic
1140117408 16:72054734-72054756 CAGAAATAGAACAAAGAAACGGG + Intronic
1140118490 16:72063337-72063359 CAGAAATAGAACAAAGAAACAGG + Intronic
1140771847 16:78212621-78212643 CTGAATTAGGTCCACGAAAGAGG + Intronic
1141001643 16:80313907-80313929 CATAATTATTTGAATGAAACTGG - Intergenic
1147480001 17:40751470-40751492 GAGAATTAGGTCAACGGGACAGG - Intronic
1147938393 17:44027097-44027119 CAGAATTAGTTCAAGTGATCTGG + Intergenic
1157066288 18:44354756-44354778 CAATATTAGATCAACGAGACAGG - Intergenic
1159925276 18:74263541-74263563 CAGAATTTATTTAACCAAACAGG + Intronic
1161546017 19:4880501-4880523 CAAAACCAGTTCAACCAAACCGG - Intergenic
939058333 2:137390010-137390032 CAGGATTGGTTCAGCTAAACTGG + Intronic
945514312 2:210743818-210743840 CAGAATGACTTCAACAAAAATGG - Intergenic
946947089 2:224832289-224832311 CAGAATTTGTTGAATGAAAAAGG - Intronic
947094662 2:226552125-226552147 CTGAATTAGAACAAGGAAACAGG + Intergenic
1169189751 20:3650754-3650776 CAGAATTAGTTCAACGAAACAGG - Exonic
1179480032 21:41671137-41671159 CAAAATTACTTAAAAGAAACTGG - Intergenic
949403137 3:3686211-3686233 CAAAATAAGTTCCAAGAAACAGG + Intergenic
953727077 3:45408829-45408851 GAGTATTAGTTAAACGAACCAGG + Intronic
958194784 3:90230603-90230625 CAGAAATAGTTCAACGGAGATGG + Intergenic
962223930 3:133588729-133588751 CAAAATAAATTCAACCAAACTGG + Exonic
964319549 3:155481030-155481052 CAGAATTATCTGAACAAAACTGG + Exonic
965688107 3:171327149-171327171 GTGACTTAGTTCAACCAAACTGG + Intronic
972238662 4:37164290-37164312 AAGAATGAGTCCAAGGAAACAGG - Intergenic
973310779 4:48707732-48707754 CAGCATTAGTTCACCAGAACTGG - Intronic
975148556 4:70995758-70995780 CAGAAGTAGTTAAGAGAAACTGG - Intronic
977297148 4:95223500-95223522 CAGAATTAGTTCCCCCAAATAGG - Intronic
978870430 4:113569454-113569476 CAGAATTATTAGAACAAAACTGG - Intronic
982589183 4:157282649-157282671 CAAAATTAGTACTACCAAACTGG - Intronic
983986720 4:174068410-174068432 CAGAATTAGTTTAAAGACACAGG + Intergenic
988405036 5:30813069-30813091 CATAACTAGTTCAATAAAACTGG - Intergenic
991473014 5:66989458-66989480 CAGAATTCATTCAAGCAAACTGG + Intronic
994053053 5:95383590-95383612 CAGAAATAGTGCATGGAAACTGG + Intergenic
1002886260 6:1297389-1297411 CAGGTTTTGTTCAACAAAACAGG + Intergenic
1006791960 6:36707667-36707689 CATAAATAGTTCATCGAACCTGG + Intronic
1006922638 6:37636700-37636722 CAGAAATAGGTCAAGGAATCTGG + Exonic
1008248149 6:49204177-49204199 CAGAATCTGTTCAAGAAAACTGG - Intergenic
1008888532 6:56458295-56458317 CAAAATGAGTTCAATGATACAGG + Exonic
1010449677 6:75988681-75988703 CAGAACTAGTTAAAGGAAGCAGG - Intronic
1010607207 6:77906083-77906105 CAGAATTAGTTTATTGAAATCGG - Intronic
1022300176 7:29095498-29095520 CAGAACTACTTCAACAAAACTGG + Intronic
1024130677 7:46349651-46349673 CAGAATTAGATTATCTAAACTGG + Intergenic
1027517565 7:79161573-79161595 CATAATTAGTTCTAGGAAAGAGG - Intronic
1028331704 7:89603104-89603126 CAGAATTATTTCCACTTAACTGG - Intergenic
1029828689 7:103230958-103230980 CAGAATTAGTTAAAAAAAATGGG + Intergenic
1032512906 7:132486312-132486334 CAGAATTATTACAAGGAAAGGGG + Intronic
1037130307 8:15400631-15400653 CAAAATGAGTTTAAGGAAACTGG - Intergenic
1038848630 8:31253062-31253084 CAGGATTATTTCAATGATACTGG + Intergenic
1043069516 8:75620866-75620888 CCAAATTAGCTCAACAAAACTGG - Intergenic
1044263290 8:90153374-90153396 CAAAATTATTGCAATGAAACAGG - Intergenic
1048272952 8:133043999-133044021 CAGAGTTAGTTCATGGAAAGTGG - Intronic
1048608875 8:136000409-136000431 AAGAATTAGCTTAACCAAACAGG - Intergenic
1051205325 9:14682614-14682636 CAACATTAGATCAACGAGACAGG + Intronic
1060333314 9:122696420-122696442 CAGAATTATTTAAACTATACTGG + Intergenic
1187732396 X:22268993-22269015 CACAATTAATACAAGGAAACAGG - Intergenic
1195303476 X:103555435-103555457 CAGAGTTATTTCAAGGAATCAGG + Intergenic
1196217888 X:113076125-113076147 CAAAATTATTTAAACCAAACTGG + Intergenic
1200990423 Y:9340564-9340586 CAGAGATAGTTCAAGGAAAGGGG + Intergenic
1200993085 Y:9360881-9360903 CAGAGATAGTTCAAGGAAAGGGG + Intronic
1200995739 Y:9381151-9381173 CAGAGATAGTTCAAGGAAAGGGG + Intergenic
1200998404 Y:9401503-9401525 CAGAGATAGTTCAAGGAAAGGGG + Intergenic
1201000912 Y:9470033-9470055 CAGAGATAGTTCAAGGAAAGGGG + Intronic
1201003580 Y:9490361-9490383 CAGAGATAGTTCAAGGAAAGGGG + Intergenic
1201006236 Y:9510643-9510665 CAGAGATAGTTCAAGGAAAGGGG + Intergenic
1201008894 Y:9530952-9530974 CAGAGATAGTTCAAGGAAAGGGG + Intergenic
1201011470 Y:9551141-9551163 CAGAGGTAGTTCAAGGAAAGGGG + Intergenic
1202116237 Y:21471154-21471176 CAGAGGTAGTTCAACAAAAGGGG + Intergenic