ID: 1169191307

View in Genome Browser
Species Human (GRCh38)
Location 20:3660613-3660635
Sequence GGACAACGTGAGCGCGCGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 39}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169191307_1169191316 10 Left 1169191307 20:3660613-3660635 CCACGCGCGCGCTCACGTTGTCC 0: 1
1: 0
2: 1
3: 5
4: 39
Right 1169191316 20:3660646-3660668 GGGTGACGGCGGTGCCTGCGGGG 0: 1
1: 0
2: 2
3: 12
4: 135
1169191307_1169191311 -4 Left 1169191307 20:3660613-3660635 CCACGCGCGCGCTCACGTTGTCC 0: 1
1: 0
2: 1
3: 5
4: 39
Right 1169191311 20:3660632-3660654 GTCCACGTAGTTAGGGGTGACGG 0: 1
1: 0
2: 0
3: 0
4: 37
1169191307_1169191313 -1 Left 1169191307 20:3660613-3660635 CCACGCGCGCGCTCACGTTGTCC 0: 1
1: 0
2: 1
3: 5
4: 39
Right 1169191313 20:3660635-3660657 CACGTAGTTAGGGGTGACGGCGG 0: 1
1: 0
2: 0
3: 3
4: 53
1169191307_1169191314 8 Left 1169191307 20:3660613-3660635 CCACGCGCGCGCTCACGTTGTCC 0: 1
1: 0
2: 1
3: 5
4: 39
Right 1169191314 20:3660644-3660666 AGGGGTGACGGCGGTGCCTGCGG 0: 1
1: 0
2: 1
3: 26
4: 247
1169191307_1169191318 20 Left 1169191307 20:3660613-3660635 CCACGCGCGCGCTCACGTTGTCC 0: 1
1: 0
2: 1
3: 5
4: 39
Right 1169191318 20:3660656-3660678 GGTGCCTGCGGGGACCCTGAGGG 0: 1
1: 0
2: 4
3: 32
4: 242
1169191307_1169191315 9 Left 1169191307 20:3660613-3660635 CCACGCGCGCGCTCACGTTGTCC 0: 1
1: 0
2: 1
3: 5
4: 39
Right 1169191315 20:3660645-3660667 GGGGTGACGGCGGTGCCTGCGGG 0: 1
1: 0
2: 1
3: 20
4: 273
1169191307_1169191310 -10 Left 1169191307 20:3660613-3660635 CCACGCGCGCGCTCACGTTGTCC 0: 1
1: 0
2: 1
3: 5
4: 39
Right 1169191310 20:3660626-3660648 CACGTTGTCCACGTAGTTAGGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1169191307_1169191317 19 Left 1169191307 20:3660613-3660635 CCACGCGCGCGCTCACGTTGTCC 0: 1
1: 0
2: 1
3: 5
4: 39
Right 1169191317 20:3660655-3660677 CGGTGCCTGCGGGGACCCTGAGG 0: 1
1: 0
2: 1
3: 19
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169191307 Original CRISPR GGACAACGTGAGCGCGCGCG TGG (reversed) Exonic