ID: 1169193268

View in Genome Browser
Species Human (GRCh38)
Location 20:3670785-3670807
Sequence ATGCCTTGCGGTGCTGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169193268 Original CRISPR ATGCCTTGCGGTGCTGGTGG TGG Intronic
900319641 1:2076195-2076217 GTCCCTTGCTGTGCTGGTCGTGG + Intronic
900420559 1:2554263-2554285 GGGCCTGGCGGTGCTGGTGCCGG + Intergenic
900423607 1:2566421-2566443 AGGCCTGGCGGTGCTGGTGCTGG - Intergenic
900963347 1:5939904-5939926 GTGCCCTGGGGTCCTGGTGGGGG - Intronic
901435828 1:9246989-9247011 AAGCCTTGCGGTTCTGGTCTCGG - Exonic
902365635 1:15972114-15972136 ATACCTTGGAGGGCTGGTGGAGG - Intronic
903162483 1:21499124-21499146 ATGGCTTGAGCTGGTGGTGGAGG - Intergenic
903560360 1:24222398-24222420 AAGCCTTGTGGTGGGGGTGGGGG + Intergenic
903627317 1:24740648-24740670 ATGCCTTGCAATGCTGGGGATGG + Intergenic
907451065 1:54546235-54546257 ATGCCTTGCTGTGTGGGGGGTGG + Intronic
916056909 1:161074269-161074291 CTGCCTTCTGGTGGTGGTGGTGG - Exonic
920387210 1:205577446-205577468 ATGCCTGGGGAAGCTGGTGGTGG + Intronic
921351922 1:214244702-214244724 ATGTTTTGCAGTGCTGGAGGTGG - Intergenic
923856772 1:237853596-237853618 ATGCTGTGTGGTGTTGGTGGGGG - Intergenic
923947150 1:238900657-238900679 AGGCCTTGCTGAGCTGGTGTGGG - Intergenic
924944137 1:248834484-248834506 ATGGCTTACGTTGCTGTTGGGGG - Intergenic
1065399901 10:25287307-25287329 ATGCCTTCAAGTACTGGTGGAGG - Intronic
1069613373 10:69790309-69790331 AAGCCTTGCTGTGGGGGTGGCGG + Intergenic
1070649319 10:78223277-78223299 TTTCCTTGTGGTGCTGATGGCGG - Intergenic
1071525242 10:86354539-86354561 CTGCCTTGGGGTTGTGGTGGTGG - Intronic
1073077733 10:100835255-100835277 ATTCTTTGGGGTGCAGGTGGTGG - Intergenic
1074140939 10:110672210-110672232 ATGCCTGGCGCCGCGGGTGGGGG + Intronic
1077331453 11:1985629-1985651 ATCCCCTGCAGTTCTGGTGGTGG + Intergenic
1078215884 11:9311538-9311560 TTGCCTTGCGGAGCTCCTGGGGG + Intronic
1079090601 11:17477316-17477338 TTACCTTGTGGTGGTGGTGGTGG + Intergenic
1080185944 11:29486462-29486484 AATCCTTGCTGTGCTGCTGGTGG - Intergenic
1080681941 11:34485739-34485761 AGGCCTTGCTTGGCTGGTGGTGG + Intronic
1083258146 11:61508952-61508974 ATGCCTGGCGGTGGCAGTGGCGG + Exonic
1083339439 11:61949633-61949655 AAGCCTGCCGGGGCTGGTGGAGG - Intergenic
1084294318 11:68201185-68201207 ATGCATTGTGGTGGTGCTGGTGG - Intronic
1085470749 11:76756362-76756384 TTTCCATGCGGTGCTGCTGGTGG - Intergenic
1087792538 11:102421930-102421952 ATGCCCTGAAGTGCTGTTGGAGG + Intronic
1089494131 11:118899925-118899947 GAGCCCTGCGGTGGTGGTGGGGG + Exonic
1202814434 11_KI270721v1_random:40805-40827 ATCCCCTGCAGTTCTGGTGGTGG + Intergenic
1091773653 12:3170000-3170022 ATGTCTTGGGGTGGGGGTGGGGG + Intronic
1092055813 12:5507179-5507201 ATGCCTGGTGGGGCTGGAGGTGG + Intronic
1096260415 12:50086475-50086497 ATGCTTGGTGGTGGTGGTGGTGG + Intronic
1096413337 12:51392241-51392263 CTGACTGGCGCTGCTGGTGGGGG - Intronic
1096860653 12:54525469-54525491 AAGCCTTCAGATGCTGGTGGTGG + Intronic
1103342769 12:120229936-120229958 CTGCCTGGGGCTGCTGGTGGAGG - Intronic
1104475182 12:129065213-129065235 CTGCCTTGCAGTTCAGGTGGGGG - Intergenic
1104636825 12:130442736-130442758 CTGCCTTATGGTCCTGGTGGGGG - Intronic
1108780135 13:53820320-53820342 ATGTTTTGTGGTGGTGGTGGTGG - Intergenic
1115454052 14:33580892-33580914 ATGTTTGGCGGGGCTGGTGGGGG - Intronic
1119709453 14:76811398-76811420 ATGTCTTTTGGTGGTGGTGGTGG + Intronic
1119996286 14:79257339-79257361 ATTCCTGGTGGTGGTGGTGGTGG + Intronic
1122358228 14:101137145-101137167 AAGCTTTACGCTGCTGGTGGAGG + Intergenic
1123720440 15:23056216-23056238 ATGCCTGGGGTTGTTGGTGGTGG + Intergenic
1124211740 15:27770088-27770110 ATGCTTGGTGGTGCTGGGGGTGG - Intronic
1125520067 15:40343540-40343562 AAGCCTGGCGGAGCTGGGGGAGG - Intergenic
1126468034 15:48978621-48978643 ATGCCTTTAGGTGAAGGTGGAGG + Intergenic
1129220970 15:74131382-74131404 ATGGGGTGCGGGGCTGGTGGGGG + Intronic
1129587985 15:76887669-76887691 AGGCCTTGCTGAGCTGTTGGGGG - Intronic
1130411769 15:83653981-83654003 TTGCCGGGCGGTGCAGGTGGCGG + Intergenic
1131021851 15:89105826-89105848 CTGGCTTGAGGTGGTGGTGGTGG + Intronic
1132625175 16:888147-888169 AAGCCTTGGGGTGCAGGGGGTGG + Intronic
1133077166 16:3288931-3288953 ATGCCTTACTCTGCTGGGGGCGG - Intronic
1134614066 16:15636125-15636147 ATGCGTTTTGGTGGTGGTGGTGG - Exonic
1136115352 16:28091082-28091104 GCTCCTTGCGGTGCTGCTGGTGG - Intergenic
1136626669 16:31465998-31466020 GTGCCTTGCGGGGTTGGGGGAGG + Intronic
1137481030 16:48852223-48852245 ATGCCTGGGGGCACTGGTGGGGG - Intergenic
1137722220 16:50633821-50633843 ATGCCTTGTGGTGTCGGGGGTGG - Exonic
1138507413 16:57485342-57485364 TTGCCTTGCTGTGCTGGTACTGG - Intronic
1139146642 16:64332638-64332660 ATGAATTGATGTGCTGGTGGTGG + Intergenic
1141695840 16:85619014-85619036 CTCCCTTGCGGTGTTGGGGGTGG + Intronic
1143459702 17:7094325-7094347 AAGCCTTGCATTGTTGGTGGTGG - Intergenic
1151936446 17:77264872-77264894 CTGCCAAGCGGCGCTGGTGGGGG - Intergenic
1152433914 17:80263782-80263804 AGGCCCAGGGGTGCTGGTGGAGG + Intronic
1152634808 17:81426489-81426511 ATGGCTCGTGGTGGTGGTGGTGG + Intronic
1152873575 17:82772708-82772730 GTGGTTTGGGGTGCTGGTGGGGG + Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1157614256 18:48977457-48977479 TTGTCTTGCGGTGGGGGTGGGGG + Intergenic
1159944554 18:74434663-74434685 ATGCCTTTCTGTGGTGGTCGGGG - Exonic
1161685472 19:5700660-5700682 AGGCCTGGGGGTGCTGGTCGGGG - Intronic
1165236465 19:34426233-34426255 TTGCCTTTGGGTGCTGGTGCCGG + Intergenic
1166015201 19:39974364-39974386 GTGCATTGCTGTGCTTGTGGAGG - Exonic
1166983806 19:46648301-46648323 ATTCCTCTCGGTGGTGGTGGGGG + Exonic
925024083 2:594405-594427 TTGCCGTGCTGTGCTGGTGCTGG - Intergenic
926006433 2:9376609-9376631 CTGCCTTGTGGTGCTGATGCAGG + Intronic
928234840 2:29530455-29530477 GTCCATTGTGGTGCTGGTGGCGG - Intronic
928400901 2:30978052-30978074 AGGCCTTGAGATGCTGGTGAAGG - Intronic
928510091 2:31994917-31994939 GTGCCTTGCGGTGGGGGTGGAGG + Intronic
929765640 2:44841997-44842019 ATGTCTTCCGTTGCTGGGGGAGG - Intergenic
930019837 2:46994875-46994897 ATTCCCTGCAGTGCTGGTGCTGG + Intronic
932798319 2:74716730-74716752 TTGTCTTGCAGTACTGGTGGAGG - Intergenic
933807798 2:86012533-86012555 GTGGCATGCGCTGCTGGTGGAGG + Intergenic
937127077 2:119481814-119481836 ATGCCTGGCGGGACTGGTGTGGG - Intronic
938230835 2:129657339-129657361 ATGCCATGGGATGATGGTGGTGG - Intergenic
943561873 2:189473556-189473578 ATGGATAGCGGTGGTGGTGGTGG - Intronic
948176258 2:235945883-235945905 ATGGCTGGCGGTGGTGGTGGGGG + Intronic
948342421 2:237265096-237265118 AGGCCTTGGGGAGCTGGTGGAGG - Intergenic
948565495 2:238883757-238883779 ATGCCTTGCGGAGAGGGAGGCGG + Intronic
1168747605 20:257746-257768 GTGGCTTGGGGAGCTGGTGGTGG - Exonic
1168876368 20:1174813-1174835 GTGCACTGCGGTGGTGGTGGGGG - Intronic
1169193268 20:3670785-3670807 ATGCCTTGCGGTGCTGGTGGTGG + Intronic
1169587072 20:7096950-7096972 ATGGCCTGTGGTGGTGGTGGTGG + Intergenic
1172583902 20:36069066-36069088 ATGCCTAGCAGTGGTGGCGGTGG + Intergenic
1173001506 20:39109126-39109148 AGGCTTTGGGGTGCTGGTTGGGG + Intergenic
1179881375 21:44294526-44294548 ATGCATGCCGGTGCTGGGGGTGG + Intronic
1181483915 22:23218751-23218773 CTGCCCTCCGATGCTGGTGGAGG + Intronic
950275108 3:11654088-11654110 ATGCTTTGTTGTGGTGGTGGTGG - Intronic
959866618 3:111277938-111277960 ATGCTTTGTTGTGGTGGTGGTGG - Intergenic
963832010 3:150018248-150018270 TTGCCTTTGGTTGCTGGTGGGGG - Intronic
965570215 3:170165013-170165035 GTGCATTGGGGTGCTGGTGGTGG - Intronic
965630420 3:170726962-170726984 CTGGCTTGTGGTGGTGGTGGAGG + Intronic
965758735 3:172052448-172052470 GTGCCTTGCTGAGCTGTTGGAGG + Intronic
968522352 4:1039686-1039708 AGGCGTGGCGGTGGTGGTGGGGG + Intergenic
975217411 4:71771284-71771306 ATGGCTTGCAGTGGAGGTGGTGG + Intronic
975732433 4:77350755-77350777 AAGCCTTGCTGTCCTGGTCGTGG + Intronic
975870954 4:78777119-78777141 ATGCCCTGCAGCGCGGGTGGAGG - Intronic
976451489 4:85196144-85196166 AAGCCTTGCGGTGCTGCAGTGGG + Intergenic
976601068 4:86937771-86937793 ATGGCTTGGGGTGGGGGTGGGGG + Intronic
976874639 4:89837593-89837615 ATCCCTTGGGGAGCTGCTGGAGG + Intronic
978347770 4:107789113-107789135 ATGCTCTGCAGAGCTGGTGGGGG - Intergenic
978505617 4:109453351-109453373 AAGCCTGGGGGTGCTGCTGGAGG + Intronic
980088870 4:128420843-128420865 ATGACCTGGGGTGGTGGTGGTGG + Intergenic
985758891 5:1734655-1734677 ACGCCCTGTGGTTCTGGTGGGGG + Intergenic
987342866 5:16953906-16953928 ATGCCATGTGGTGCTGGAAGAGG - Intergenic
991631448 5:68660541-68660563 TTGCCTTGAGGGGCTGGTGAAGG - Intergenic
993316397 5:86411828-86411850 ATGTCTTGCTGTGCTTGTGCTGG - Intergenic
997006660 5:129824918-129824940 ATGTTTTGTGGTGCTGCTGGTGG - Intergenic
998153375 5:139769827-139769849 CTGGCTTGCGGTGAGGGTGGAGG + Intergenic
999260742 5:150237379-150237401 ATGCCTGGTGGTGGTGGTAGTGG - Intronic
999784573 5:154879761-154879783 ATGCCCTGTGTTGGTGGTGGGGG + Intergenic
1001593931 5:172885797-172885819 AGGCCTTGCGGAGCTGGAAGAGG - Intronic
1002381449 5:178832344-178832366 CAGCTTTGCGGTGCTGGCGGTGG - Intergenic
1002788123 6:419313-419335 ACACATTGGGGTGCTGGTGGGGG - Intergenic
1002836487 6:869231-869253 ATGCCCTGGGCTGGTGGTGGAGG + Intergenic
1003202026 6:3970038-3970060 ATTCCTGGTGGTGGTGGTGGTGG + Intergenic
1003778754 6:9398952-9398974 AGGCCTTGTAGTGCGGGTGGGGG - Intergenic
1004879712 6:19995804-19995826 AGGCCTTGTGGTTCTGGCGGTGG - Intergenic
1005916296 6:30354931-30354953 ATGCCTTATTGTGCTGGTGAAGG - Intergenic
1006293236 6:33157013-33157035 ATGCCTTTTGGTGGAGGTGGAGG - Intergenic
1006986204 6:38177342-38177364 AAGGCTTGCGGGGCCGGTGGGGG - Intronic
1008653357 6:53586071-53586093 ATCCCTGGAGGTGCTGGAGGGGG - Intronic
1012718119 6:102702190-102702212 ATGCTCTGTGGAGCTGGTGGGGG - Intergenic
1013944735 6:115708000-115708022 ATGCCTTGGGGTGTGGGTGGTGG - Intergenic
1014778121 6:125533771-125533793 ATGCCGTGCGGTGTTGTTTGGGG + Intergenic
1016757154 6:147699157-147699179 AAGAATTGGGGTGCTGGTGGGGG - Intronic
1016933440 6:149430679-149430701 ATGACTTGCATTGCTGGTGATGG + Intergenic
1017931454 6:158959081-158959103 CTGCCCTGGGGTCCTGGTGGTGG + Intergenic
1018662908 6:166105037-166105059 AGGCCCTGCAGTGCTGGCGGTGG + Intergenic
1018991406 6:168676717-168676739 ATGGCTTGCGGTGCTGGAGCGGG - Intergenic
1022953662 7:35362383-35362405 AAGCCTTGAGGTGCTGCTGGTGG - Intergenic
1029183736 7:98723308-98723330 ATTCTTTGCGGTGGTGGAGGAGG - Intergenic
1033370451 7:140702855-140702877 TTGTCTTGCAGTGCCGGTGGTGG + Exonic
1033373761 7:140736879-140736901 ATTTCTTGTGGTGGTGGTGGTGG - Intronic
1033737633 7:144239104-144239126 ATGCTTTGGGGAGCTGGTGAGGG + Intergenic
1033745423 7:144311853-144311875 ATGCTTTGGGGAGCTGGTGAGGG - Intergenic
1034491520 7:151395620-151395642 AGGCCTTGCGGTCCTGGGGCTGG - Intronic
1034966465 7:155394527-155394549 ATGCCATGGGGTCATGGTGGCGG - Intronic
1037853090 8:22348914-22348936 ATTCCTTTCGGTTCTGTTGGAGG + Intronic
1038309367 8:26434178-26434200 AGGCACTGCTGTGCTGGTGGCGG + Intronic
1040568833 8:48590652-48590674 ACCCCGTGTGGTGCTGGTGGAGG - Intergenic
1041091706 8:54307443-54307465 ATGAGTTACAGTGCTGGTGGCGG + Intergenic
1042839580 8:73110264-73110286 ATGCCCTAGGGTGCTGGAGGGGG + Intronic
1044490563 8:92809330-92809352 ATGACTTGGGATGCTGGTGGTGG - Intergenic
1045174395 8:99706162-99706184 ATTGGTTGCGGTGGTGGTGGTGG - Intronic
1049367044 8:142244860-142244882 ATGCCTTCCGCTGCAGGTGCAGG - Intronic
1050323697 9:4479671-4479693 CTGCCTTGCTGTGTTGGTGTTGG + Intergenic
1052102841 9:24471416-24471438 ATACCTGGTGGTGGTGGTGGTGG - Intergenic
1053106462 9:35413295-35413317 TTGTCTTGTGGTGGTGGTGGTGG - Intergenic
1057217303 9:93236187-93236209 AGGCCTTGGGGTGCTGGTGTGGG + Intronic
1057605648 9:96496398-96496420 AGGCCCTGTGGTGGTGGTGGTGG - Intronic
1059526347 9:114994085-114994107 ATGCCCTGTGGTGTTGGAGGAGG + Intergenic
1060158615 9:121338818-121338840 AAGCTTTGTGGTGGTGGTGGAGG + Intergenic
1062007659 9:134249340-134249362 ATGGCTTCCGGTTCTGGTCGCGG + Intergenic
1185934715 X:4242892-4242914 ATACCTTGAGGTGGTGGTGGTGG - Intergenic
1186433951 X:9527767-9527789 ATGAATGGCGGTGATGGTGGCGG - Intronic
1186649532 X:11543498-11543520 ATTCTTTGTGGTGGTGGTGGTGG - Intronic
1187963028 X:24584579-24584601 ATCCCCTGCAGGGCTGGTGGTGG - Intronic
1188002139 X:24993273-24993295 TGGCTTTGTGGTGCTGGTGGCGG + Intronic
1190331980 X:49241883-49241905 AGGCCTTGGGGAGCTGGGGGAGG + Intronic
1196218958 X:113088671-113088693 ATACCTTGCCTTTCTGGTGGAGG - Intergenic
1197331857 X:125162630-125162652 AAGACTTGAGGTGCTGGTGGAGG - Intergenic
1199156180 X:144551394-144551416 ATGGCCTGTGGTGGTGGTGGTGG + Intergenic
1200228968 X:154434607-154434629 ATGGCATGGGGTGCTGTTGGAGG + Intronic
1200292282 X:154885582-154885604 TTGCCTTGGGGTGGGGGTGGGGG + Intronic
1200339119 X:155381319-155381341 TTGCCTTGGGGTGGGGGTGGGGG + Intergenic
1200347350 X:155459373-155459395 TTGCCTTGGGGTGGGGGTGGGGG - Intergenic