ID: 1169193935

View in Genome Browser
Species Human (GRCh38)
Location 20:3673546-3673568
Sequence CTCCCTCGCCCCCGCCCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 312}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169193926_1169193935 27 Left 1169193926 20:3673496-3673518 CCTGGGGGGCCGTGGGAGGGCGG 0: 1
1: 0
2: 3
3: 44
4: 463
Right 1169193935 20:3673546-3673568 CTCCCTCGCCCCCGCCCGCGGGG 0: 1
1: 0
2: 4
3: 48
4: 312
1169193930_1169193935 -5 Left 1169193930 20:3673528-3673550 CCGTAGAGCCTCCTGTCTCTCCC 0: 1
1: 0
2: 4
3: 43
4: 361
Right 1169193935 20:3673546-3673568 CTCCCTCGCCCCCGCCCGCGGGG 0: 1
1: 0
2: 4
3: 48
4: 312
1169193928_1169193935 18 Left 1169193928 20:3673505-3673527 CCGTGGGAGGGCGGTCACTGCGG 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1169193935 20:3673546-3673568 CTCCCTCGCCCCCGCCCGCGGGG 0: 1
1: 0
2: 4
3: 48
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169193935 Original CRISPR CTCCCTCGCCCCCGCCCGCG GGG Intronic