ID: 1169195154

View in Genome Browser
Species Human (GRCh38)
Location 20:3678856-3678878
Sequence TGGCACAAACAGATGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169195149_1169195154 3 Left 1169195149 20:3678830-3678852 CCTCTTAGTTTGCAGCACAGATA No data
Right 1169195154 20:3678856-3678878 TGGCACAAACAGATGGGGCATGG 0: 1
1: 0
2: 2
3: 19
4: 236
1169195148_1169195154 4 Left 1169195148 20:3678829-3678851 CCCTCTTAGTTTGCAGCACAGAT 0: 1
1: 0
2: 2
3: 86
4: 1011
Right 1169195154 20:3678856-3678878 TGGCACAAACAGATGGGGCATGG 0: 1
1: 0
2: 2
3: 19
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169195154 Original CRISPR TGGCACAAACAGATGGGGCA TGG Intronic
900895963 1:5483116-5483138 AGGCACAGACAGAGGGGGGATGG - Intergenic
902099008 1:13969660-13969682 TGCCACAAAGAGTTGGGGAAAGG - Intergenic
903499908 1:23795119-23795141 GGGCAGAATCAGTTGGGGCAGGG - Exonic
904946910 1:34206125-34206147 TGGCACAAGCAGGTGTGGGATGG + Intronic
906200049 1:43954185-43954207 TGGCACAAAGAGAAGGGGCAGGG - Intronic
906260859 1:44388662-44388684 TGGAACAAAAAGATGGAGGAAGG - Intergenic
906264916 1:44421469-44421491 TGACACACACAGATGGGGGAAGG - Intronic
906994045 1:50770984-50771006 TGACAAAAACAAATGGGGAAAGG + Intronic
909340315 1:74524320-74524342 TGCCAGAAACAGAGGGGGCTTGG + Intronic
909851063 1:80464647-80464669 TGGCACAGATAGCTGGGGCCTGG - Intergenic
910008104 1:82425095-82425117 TGGAACAATAAGCTGGGGCAGGG - Intergenic
910502049 1:87903511-87903533 TGGCACAAAAATGTGGTGCATGG - Intergenic
911040020 1:93583933-93583955 TGAGACAACTAGATGGGGCAGGG + Intronic
911711367 1:101077517-101077539 TCTCGCAAACAGATGGGTCATGG + Intergenic
913616537 1:120565612-120565634 TTGCACAAACAGGTGGGGGCTGG - Intergenic
914573740 1:148945299-148945321 TTGCACAAACAGGTGGGGGCTGG + Intronic
915254542 1:154616365-154616387 GGGGACAGAGAGATGGGGCATGG - Intronic
915692526 1:157703913-157703935 AGACACAAACAATTGGGGCATGG + Intergenic
916554457 1:165882103-165882125 TGGCACAAACAGGTGCCGAAAGG + Intronic
917285208 1:173415994-173416016 TGCAGCAAACCGATGGGGCAGGG + Intergenic
923255871 1:232220942-232220964 AGGCACACACAGCTGGGCCATGG + Intergenic
923777317 1:236991260-236991282 AGGCACAAAGAGATGAGTCAGGG - Intergenic
1063122565 10:3115074-3115096 AGGCATAAACAGAGGAGGCAAGG + Intronic
1063382807 10:5596945-5596967 TGGCTGAAACCGATGGGGCAGGG - Intergenic
1063567925 10:7188540-7188562 TGTCACAAAGAGAAGTGGCAAGG + Intronic
1067444041 10:46329505-46329527 TGGCTCAAAGGGATGGGGCCAGG - Intronic
1069914230 10:71777563-71777585 TGACTCAAACAGAAAGGGCAAGG - Intronic
1069942692 10:71965829-71965851 TGGCCCAAGCAGATCAGGCAGGG - Intronic
1070350892 10:75591352-75591374 AGTTAAAAACAGATGGGGCAAGG + Intronic
1071371700 10:84957889-84957911 TGGCACACCCAGATGGGGTGTGG + Intergenic
1071719030 10:88124061-88124083 TGGACCAAACAGATGGAGTATGG + Intergenic
1072408034 10:95173039-95173061 GAGCACAGACAGATGGGGCCTGG - Intergenic
1073867237 10:107818981-107819003 TGGAGCAGACAGATGGGGCTGGG + Intergenic
1074126735 10:110534630-110534652 TGCCACAGACATATGGGGAAGGG - Intergenic
1075040138 10:119101618-119101640 TGTCACAGACAGATGGAGCTGGG - Intergenic
1077353837 11:2105593-2105615 GGGCAGAGACAGATGGGACAGGG - Intergenic
1077377890 11:2214064-2214086 AGGAACAAACAGGTGGAGCATGG - Intergenic
1077456763 11:2686036-2686058 TCGCACCATCTGATGGGGCAGGG + Intronic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1080308428 11:30862077-30862099 TGGAATAAACAAATGGGCCATGG + Intronic
1080441307 11:32297266-32297288 TCTCCCAAATAGATGGGGCATGG - Intergenic
1084979532 11:72821852-72821874 TGGCACCAACCGATGGGGTCGGG - Intronic
1085355451 11:75832527-75832549 TGGCACACCCAGAGAGGGCATGG - Intronic
1088702327 11:112424518-112424540 TGGAGGAATCAGATGGGGCATGG + Intergenic
1089072450 11:115710939-115710961 TGGCTCAAACATCTGGGGGATGG + Intergenic
1089389227 11:118088677-118088699 TGGCCCAAACAGAAAGGGAAAGG + Intronic
1089451488 11:118600911-118600933 TGGCACAAACATAAAGGGAAAGG + Exonic
1089781803 11:120878463-120878485 TGGCTCAAAAAGATGGGGGTAGG - Intronic
1090030577 11:123202737-123202759 TGGCAGAAACAGGTGGGACAGGG + Intergenic
1093414174 12:18901319-18901341 TGTTAAAAACAGTTGGGGCAAGG + Intergenic
1094065695 12:26358776-26358798 TGGCAGCCACAGATGGGGGAGGG - Intronic
1094359197 12:29611787-29611809 TGTTTCACACAGATGGGGCAGGG + Intronic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1100197944 12:92268697-92268719 TGACAGAGACTGATGGGGCAAGG + Intergenic
1100400085 12:94221778-94221800 TCTCACATACAGAAGGGGCAGGG + Intronic
1100411793 12:94326187-94326209 TGGCTCACACAGAGAGGGCATGG + Intronic
1102688553 12:114742610-114742632 GGACCCACACAGATGGGGCAGGG + Intergenic
1105308268 13:19184075-19184097 TGGCACAAAGAGGAGGAGCAGGG + Intronic
1105450168 13:20492576-20492598 TGGCAGAAACAGGTGGGGCAGGG - Intronic
1105717833 13:23084878-23084900 TGGAACACACAGAGGAGGCATGG + Intergenic
1106911074 13:34464265-34464287 TGGCACAACCATAGGAGGCAGGG - Intergenic
1107018811 13:35731039-35731061 TGGCACACCCAGAGGGGGCTTGG - Intergenic
1107861768 13:44667619-44667641 TGGCTCTCACAGATGGGGCAGGG + Intergenic
1110488408 13:76073130-76073152 TGGCACGTCCAGAGGGGGCATGG + Intergenic
1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG + Intergenic
1110622071 13:77608146-77608168 TGCCACAAATGGATGGGGAAGGG - Intronic
1112590271 13:100757079-100757101 TGGCAGAAGCAGAAGGGGCTCGG + Intergenic
1112768396 13:102771522-102771544 TCACACACACAGATGGGGAAAGG - Intronic
1113147056 13:107218759-107218781 TGTCACACAAAGATGGGGAATGG + Intronic
1115747359 14:36451316-36451338 TGGCAAAAAGACATGGGGTATGG - Intergenic
1117511802 14:56459281-56459303 TGACAAAAACAAATGGGGAAAGG + Intergenic
1120650576 14:87127784-87127806 TAGCACAAAGAGATGGAGGAAGG + Intergenic
1121349261 14:93160578-93160600 TTGCACATACTGATGGGGGATGG + Intergenic
1126165876 15:45653442-45653464 TGGAAGAGACATATGGGGCAAGG + Intronic
1126354642 15:47782477-47782499 TGGAAACAACAGATGGTGCATGG + Intergenic
1126596899 15:50392127-50392149 TGGCACACGCAGAGAGGGCATGG + Intergenic
1127337875 15:58008102-58008124 TGTCTCAAACAGATGAGGGAAGG - Intronic
1127933979 15:63618265-63618287 TGACAGAAACAAATGGGGAAAGG - Intronic
1128111505 15:65079118-65079140 TGGCAAAAACAGGGTGGGCAAGG - Intergenic
1128662291 15:69510912-69510934 TGGAACAAAAAGATGGGGGAAGG + Intergenic
1129913542 15:79247756-79247778 TGGAATAAGAAGATGGGGCAGGG + Intergenic
1132400427 15:101501826-101501848 TGGCAGGAAGAGATGGGGCCGGG - Intronic
1132713210 16:1278392-1278414 GGGCACACAGAGATGGGGGAGGG - Intergenic
1133612067 16:7442593-7442615 AGGCCTAAACAGATGAGGCAGGG + Intronic
1136551434 16:30984483-30984505 TGGCAGGAACAGATGAGGCAGGG - Exonic
1138473873 16:57259219-57259241 TGGTACAAAGAGATGGGTCATGG - Intronic
1142224175 16:88869608-88869630 AGGCACAGACACACGGGGCAGGG - Intergenic
1143510736 17:7393942-7393964 AGGCAGAGAAAGATGGGGCAGGG + Intronic
1143576468 17:7796669-7796691 TGGGCCAAGCAGAAGGGGCAAGG - Intronic
1144004228 17:11085703-11085725 TGGCACAGTCAGAAGGGGAAAGG - Intergenic
1144947918 17:18979218-18979240 GGGCACCACCACATGGGGCATGG - Intronic
1147568330 17:41551435-41551457 AGGTACAAAAAGTTGGGGCAGGG - Intergenic
1147632480 17:41941010-41941032 TGGCAAAAACAGAGAGGGGAAGG - Intronic
1148148845 17:45384255-45384277 TGGGAAAGACAGATGGGGGAAGG + Intergenic
1150725729 17:67649925-67649947 TGGCACACCCAGAGGGGGCACGG - Intronic
1151093894 17:71474426-71474448 TGGCACAAACAGATTGGCACTGG - Intergenic
1151665539 17:75543316-75543338 CGGCCCAAACAGGTGGAGCAGGG - Intronic
1153697348 18:7657427-7657449 TGGCACCAACTGCTCGGGCAAGG - Intronic
1154365847 18:13708300-13708322 TGGCACACCCAGAGAGGGCATGG - Intronic
1155331340 18:24721646-24721668 TAGAAAAAACAGATGGGCCAAGG - Intergenic
1157528166 18:48400906-48400928 GGCCACACAAAGATGGGGCACGG - Intronic
1158112069 18:53951491-53951513 TGGCACATGCATATGGGACATGG - Intergenic
1158312392 18:56171902-56171924 AGGCAAAAACAGGTTGGGCATGG - Intergenic
1158441619 18:57479822-57479844 TGGCACACCCAGATGGGACAGGG - Exonic
1162238743 19:9329950-9329972 TAAAACAAACAGGTGGGGCACGG - Intronic
1165059001 19:33195703-33195725 AGGCTCACACAGCTGGGGCAAGG - Intronic
1165906840 19:39199405-39199427 AGGCTCAAACAGAAGGGGCCAGG - Intronic
1166117395 19:40664088-40664110 AGGCACAGGCAGATGGGTCAGGG + Intergenic
1166315865 19:41989228-41989250 TGTCACATAGAGGTGGGGCACGG - Intronic
1168471896 19:56646803-56646825 TGGCCCAAACAGATGGATAAAGG + Intronic
925362400 2:3288744-3288766 TGGCAGCATCAGATGGCGCATGG + Intronic
926233154 2:11019969-11019991 TGGTACAAGCTGATGGGGCAGGG + Intergenic
927020367 2:19010441-19010463 TGGTACAAAGAGATGCTGCAGGG - Intergenic
928574512 2:32641556-32641578 TGCAACAATCAGATGGAGCAGGG - Intronic
928702919 2:33917461-33917483 TGGCACAACCAGCTGTGGCAGGG + Intergenic
928907216 2:36381010-36381032 TGGGACAAAGTCATGGGGCAGGG - Intronic
929730535 2:44486723-44486745 TGGCCCAAACTGATGGGCCTGGG - Intronic
934154485 2:89183448-89183470 TGACAAAAACAAATGGGGAAAGG + Intergenic
934212751 2:89998492-89998514 TGACAAAAACAAATGGGGAAAGG - Intergenic
935141761 2:100359438-100359460 TGGCACATCCAGAGAGGGCATGG - Intergenic
935427004 2:102930034-102930056 TGGCACAAAGAGAAAGAGCAGGG - Intergenic
940301476 2:152180217-152180239 TGGCACTACCAGCTGTGGCAGGG + Intergenic
947489276 2:230579825-230579847 TAGCACACACAGAAGGGGGAAGG - Intergenic
947927396 2:233933709-233933731 TAGCAAGAACAGATGGGGCGGGG + Intronic
948473961 2:238204312-238204334 TGGCACAAACAGCTAGGCCTGGG + Intergenic
948551929 2:238778566-238778588 TGGCACAAACCCATGGGAGAGGG + Intergenic
1168879095 20:1191463-1191485 TGGCACAAACAGCTGGGAGCTGG + Intergenic
1169195154 20:3678856-3678878 TGGCACAAACAGATGGGGCATGG + Intronic
1170581206 20:17700889-17700911 TGGCACTCACAGATGGTGAATGG - Intronic
1171229224 20:23469080-23469102 TGGCACTACCAGCTGTGGCAGGG - Intergenic
1171429961 20:25076832-25076854 TTGCACAAACAGGTGGGGGAGGG - Intronic
1173003973 20:39125577-39125599 TGACACAAACAGAAGGGAGAAGG - Intergenic
1173675381 20:44830323-44830345 TTACGCAAACAGATGGTGCATGG - Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1175839958 20:62020347-62020369 TGGCACAAGCATCAGGGGCACGG + Intronic
1176184177 20:63769190-63769212 TGGGCCAAACACTTGGGGCATGG - Intronic
1176298414 21:5086618-5086640 TCCCAGAACCAGATGGGGCAGGG + Intergenic
1178402318 21:32297518-32297540 TGGAAGAGACACATGGGGCAGGG - Intronic
1179064266 21:38009386-38009408 TGGCACACAGAGATGAGGGAGGG + Intronic
1179112445 21:38459030-38459052 GGGCATAAAGAGATGGGGGATGG - Intronic
1179858612 21:44175331-44175353 TCCCAGAACCAGATGGGGCAGGG - Intergenic
1179884908 21:44309745-44309767 TGGTACAACCAGAGGGGGCCAGG + Intronic
1181924910 22:26350520-26350542 TTGCCCAAAGAGGTGGGGCACGG - Intronic
1182038595 22:27218819-27218841 TGGGAAAACGAGATGGGGCAGGG + Intergenic
1182626178 22:31648203-31648225 TGTCACCAACAGAATGGGCAGGG + Intronic
1183366571 22:37410156-37410178 TGCGGCAAACAGACGGGGCAGGG + Intronic
1183568371 22:38633006-38633028 AGGCACTCCCAGATGGGGCAAGG + Intronic
1183604280 22:38859644-38859666 AGGGGCAAACAGATGGGGCTGGG + Intergenic
1184863541 22:47190413-47190435 AGGGACAGACAGATGGGGCGGGG - Intergenic
1185294296 22:50045763-50045785 TGAGACAGACTGATGGGGCAGGG - Intronic
950737660 3:15023326-15023348 TGGCAGACAAAGATGGAGCAAGG + Exonic
950767794 3:15286286-15286308 CGGCACAAACTGGTGTGGCAGGG + Intronic
951145207 3:19218733-19218755 TAGCACCAACAGAGGGAGCAGGG - Intronic
951164039 3:19462893-19462915 TGACAAAAACAAATGGGGAAAGG - Intronic
951233009 3:20201317-20201339 TGGCACACACAGCTGGACCATGG + Intergenic
953849814 3:46456921-46456943 TTCCACAGACAGATGGGGAATGG + Intronic
955961795 3:64348301-64348323 TGGCTCAAACACAGGGAGCAGGG + Intronic
956030577 3:65032955-65032977 TGGCACAATCAGTTAGTGCACGG + Intergenic
957959891 3:87236046-87236068 TGGCACACACAGAGAGGGCATGG - Intronic
958874917 3:99605056-99605078 TGACAAAAACAAATGGGGAAAGG - Intergenic
959611769 3:108302991-108303013 AGCAACAAAGAGATGGGGCATGG - Intronic
961042229 3:123685738-123685760 AGGCAGAGGCAGATGGGGCAGGG - Intronic
962984988 3:140527905-140527927 TGGGACTAATAGATGGGGGAGGG + Intronic
963047855 3:141116391-141116413 TGGCACCACCACATGGAGCAGGG + Intronic
964836953 3:160949624-160949646 TGGCAGAAAAGGATGGGGAATGG - Intronic
968326063 3:197817557-197817579 TGGCCCACACAGATGGGAAAAGG + Intronic
969620814 4:8277892-8277914 GGGCACTAAAAGAAGGGGCAGGG + Intronic
970176235 4:13342119-13342141 TGGGACTCACAGATGGGGGATGG - Intergenic
972138014 4:35917260-35917282 TGGCAGAAACTGATGGTCCAAGG + Intergenic
972216304 4:36900635-36900657 TGCCAGAAACATGTGGGGCAAGG - Intergenic
973161716 4:47026228-47026250 TGATACAAACTGTTGGGGCAAGG - Intronic
973240617 4:47952627-47952649 TGGTACAATCACATTGGGCATGG + Exonic
975853301 4:78595808-78595830 TGGTGAGAACAGATGGGGCACGG + Exonic
978228040 4:106362597-106362619 AACCACAAACAAATGGGGCAGGG - Intergenic
979398989 4:120224497-120224519 CTGGACAAACAGATGGGGCGGGG - Intergenic
981434082 4:144699383-144699405 TGGCACACCCAGAGAGGGCAGGG - Intronic
982873504 4:160614163-160614185 TGGCACCTACAGAGGGAGCAAGG + Intergenic
983175931 4:164587743-164587765 TGACAAAAACAAATGGGGAAAGG + Intergenic
984886997 4:184457966-184457988 TGGAACAAACAGATGAAGGAGGG - Intronic
985296791 4:188444725-188444747 GGGCACAGAGAGATGGGACAAGG + Intergenic
986644977 5:9907843-9907865 AGGCACAGACTGAAGGGGCATGG - Intergenic
990306963 5:54503371-54503393 TGGCACTACCAGCTGTGGCAGGG + Intergenic
990473689 5:56141624-56141646 TGGCACACCCAGAGAGGGCACGG + Intronic
992948375 5:81832237-81832259 TAGAACAAAAAGATGGAGCAAGG - Intergenic
994327846 5:98469676-98469698 TGACACAAACAAATGGGAAAAGG + Intergenic
995711532 5:115041014-115041036 TGGCACTACCAGCTGTGGCAGGG + Intergenic
998455462 5:142269271-142269293 TGCCAGGAACATATGGGGCAAGG + Intergenic
1003013692 6:2450789-2450811 TAGCACAAGCAGGTGGGGCATGG + Intergenic
1005120086 6:22380066-22380088 GGAGACAAAGAGATGGGGCAGGG - Intergenic
1006327457 6:33365138-33365160 GGGCAGAATCAGTTGGGGCAGGG + Intergenic
1007260342 6:40559044-40559066 TGGATCAAACGGAGGGGGCATGG + Intronic
1008476547 6:51940516-51940538 GGTCCCACACAGATGGGGCATGG - Intronic
1008656548 6:53619756-53619778 TGGCACATGCAGAGAGGGCATGG - Intergenic
1009730253 6:67593205-67593227 TGGCACAATCAGAAGGTCCATGG - Intergenic
1010970024 6:82253296-82253318 TGGCACACACAGGGAGGGCATGG + Intergenic
1011771583 6:90679181-90679203 TGCAACAAACACATGGGACAGGG - Intergenic
1013066867 6:106692664-106692686 TGGCAGAAAGAGAGGGTGCAGGG + Intergenic
1013164265 6:107575563-107575585 TGGAACAAACAGAAGGGGTGGGG + Intronic
1013328801 6:109076567-109076589 AGGCACTGACAGATGGCGCAAGG + Intronic
1013521701 6:110939295-110939317 TGGCACAGACACGTGGGGCTGGG + Intergenic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1015201898 6:130592259-130592281 TGGCACAATGACATGGAGCAAGG + Intergenic
1017116771 6:150985087-150985109 TGGCACAAATAGAAGAGTCAGGG + Intronic
1018211533 6:161487352-161487374 TGGCTCACACAGATGGGCGAAGG - Intronic
1021745620 7:23738288-23738310 TGGCACACTCAGAAAGGGCATGG - Intronic
1022479764 7:30735070-30735092 TGGAAGAAACAGATTGTGCAGGG - Intronic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022873193 7:34500906-34500928 TGGCCAAAAGAGAAGGGGCAAGG - Intergenic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1023119163 7:36892205-36892227 TGGCACACACAGAGGGAGGAGGG + Intronic
1024274886 7:47669483-47669505 TGGAACATAGAGATGGGGGAGGG + Intergenic
1024541737 7:50480316-50480338 TGGCATACACAGAGAGGGCATGG + Intronic
1024911305 7:54450200-54450222 TGGCACTACCAGTTGTGGCAGGG - Intergenic
1024933146 7:54685796-54685818 TGGCCATAGCAGATGGGGCACGG + Intergenic
1026302799 7:69112495-69112517 TAGCACAAAGAGATGAGGAAAGG + Intergenic
1026771933 7:73207649-73207671 TGGCACACGCGGATAGGGCACGG - Intergenic
1026912641 7:74100231-74100253 TGTCTCAAAAAAATGGGGCAGGG + Intronic
1027012801 7:74761045-74761067 TGGCACACGCGGATAGGGCACGG - Intergenic
1027075239 7:75185008-75185030 TGGCACACGCGGATAGGGCACGG + Intergenic
1027434695 7:78152348-78152370 TGGCAAAAACAGATGCCCCAGGG + Intronic
1027703432 7:81498235-81498257 TGGCTCAGAGAGATTGGGCAGGG - Intergenic
1029015855 7:97314910-97314932 AGGCACAATGAGATGGAGCAGGG - Intergenic
1029724163 7:102391091-102391113 TGACTCACACAGATGGGACAGGG - Intronic
1031367826 7:120924932-120924954 TGGATCAAACAGAGGGGTCAGGG - Intergenic
1032759222 7:134923170-134923192 TGGCACAAACACTTGGAGAAAGG - Intronic
1034058121 7:148058317-148058339 TGGCATAAACAGATGCTGCTGGG - Intronic
1034920795 7:155079802-155079824 TGGACCAAACAGATGGAGAAGGG + Intronic
1035138094 7:156727571-156727593 TGGCAATAACAGATGGCACAAGG + Intronic
1036154300 8:6327536-6327558 TGGAATAAACAGATGGGGGAAGG - Intergenic
1037677698 8:21066041-21066063 TGGTACAAACAGAAGGGTCTGGG - Intergenic
1037934891 8:22908985-22909007 TGGCAAAGAGAGATAGGGCAGGG + Intronic
1039972826 8:42334909-42334931 TGGCACGAAGAGATGAAGCATGG - Intergenic
1040381553 8:46877888-46877910 TGGCACTACCAGCTGTGGCAGGG - Intergenic
1043843217 8:85133808-85133830 TGGCATAAACAGAGGGGGGTAGG - Intronic
1047387781 8:124425846-124425868 TGGCTCAAAAGGATGGGGCAAGG - Intergenic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1055122935 9:72683943-72683965 TGGAACTAAAAGATGGGGTAGGG - Intronic
1055508507 9:76971424-76971446 GGGCAGAATCAGTTGGGGCAGGG - Intergenic
1056956516 9:91086086-91086108 TGGCACACTCAGAGGGGGCATGG + Intergenic
1057188507 9:93072540-93072562 TGGCACACATGGCTGGGGCAAGG + Intronic
1061366196 9:130173303-130173325 TGGCAGACAGAGATGGGGCCAGG - Intronic
1061555850 9:131368400-131368422 TGGTATAAAGAGATGGGGCTGGG + Intergenic
1061622198 9:131817947-131817969 GGGGACAAAAAGATGGGGCGTGG - Intergenic
1062077043 9:134595144-134595166 GGGCCCCAACAGCTGGGGCAAGG - Intergenic
1062417906 9:136462588-136462610 TGGCACACACAGCAGGGGCACGG + Intronic
1062648090 9:137560349-137560371 AGGAAAAAACAGGTGGGGCAAGG + Intronic
1189719016 X:43895929-43895951 TGTCACAAACAAATAGGGGAGGG - Intergenic
1190260065 X:48791935-48791957 TGGGACACACAGTTGAGGCAGGG - Exonic
1192443597 X:71193560-71193582 GGGCAGGAACAGCTGGGGCAGGG - Intergenic
1194017914 X:88648585-88648607 TGGCCAAAACACATGGGGCGGGG - Intergenic
1194566396 X:95494282-95494304 TGGCTGAAGCAGCTGGGGCACGG - Intergenic
1194740314 X:97564722-97564744 TTGCAGAAACAAATGGGGAAAGG + Intronic
1200183560 X:154166924-154166946 TGTTACAAATAGGTGGGGCACGG + Intergenic
1200189214 X:154204052-154204074 TGTTACAAATAGGTGGGGCACGG + Intergenic
1200194969 X:154241861-154241883 TGTTACAAATAGGTGGGGCACGG + Intergenic
1200200619 X:154278982-154279004 TGTTACAAATAGGTGGGGCACGG + Intronic
1200281914 X:154784336-154784358 TGGCTCAGAGAGATAGGGCAAGG - Intronic
1200354848 X:155537724-155537746 TGGCACAGAGAGAGGGGACAAGG - Intronic