ID: 1169195824

View in Genome Browser
Species Human (GRCh38)
Location 20:3681618-3681640
Sequence TGGGCTGCCCCCGAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169195810_1169195824 12 Left 1169195810 20:3681583-3681605 CCAGGAAGAGGGGGCTACGGCTA 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1169195824 20:3681618-3681640 TGGGCTGCCCCCGAGGGGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169195824 Original CRISPR TGGGCTGCCCCCGAGGGGGA GGG Intronic
900119306 1:1041751-1041773 TGGGCGGCTCCCCCGGGGGAGGG + Intronic
900119326 1:1041798-1041820 TGGGCGGCTCCCCCGGGGGAGGG + Intronic
900142390 1:1144168-1144190 TGGGCAGCCGCCGAGGGTGATGG - Intergenic
900223859 1:1523712-1523734 TAGGCTGCCCCTGAGGTGGGAGG + Intronic
901423120 1:9164069-9164091 TGGGATCCCCCAGAGGAGGAAGG + Intergenic
901988181 1:13092197-13092219 TGGGTTTCCCCCCAGTGGGAGGG + Intergenic
901993631 1:13134570-13134592 TGGGTTTCCCCCCAGTGGGAGGG - Intergenic
902379068 1:16044164-16044186 GCGGCTGCCACCGAAGGGGAAGG + Intronic
903518590 1:23929810-23929832 TGTGCTGTCCCCGCGGGGGTGGG + Intergenic
903573270 1:24321925-24321947 TGGGCTGCGGCCGAGGGCGCCGG + Intronic
904015676 1:27418553-27418575 GGGGCTTCCCCAGAGGGGGAGGG - Intronic
904256983 1:29260234-29260256 GGGGCTGGCTTCGAGGGGGACGG + Intronic
906745288 1:48217106-48217128 TGGCCTGCCCCCTAGGGGTTGGG - Intergenic
909075627 1:71047682-71047704 TGGGCTGCCCCCCATGGTGCGGG + Exonic
912435533 1:109658543-109658565 TGGGCTGACCCAGAGGAGGGTGG + Intronic
914430914 1:147619781-147619803 TTCTCTGCCCCCGAGGGGCATGG + Exonic
915982005 1:160426138-160426160 TAGGCAGCCCCTGAGGAGGAGGG + Exonic
917482249 1:175422529-175422551 TGGGGTGGCCCCGAGAGGGCTGG + Intronic
921073510 1:211681994-211682016 TGTGCTGCCCCCGATGGAAAAGG - Intergenic
921298991 1:213732203-213732225 TGAGCTACCCCTGATGGGGAAGG + Intergenic
922615833 1:226960771-226960793 TGGGCTGACCCTGAGGGGTCAGG + Intronic
922798491 1:228353212-228353234 TGGGCTGGCACCGTGGGGCAGGG + Intronic
923624984 1:235606541-235606563 TGGGCTGACCACCAGGGAGATGG + Intronic
1063140232 10:3250259-3250281 TGGTGTGCCCCCCAGGGTGATGG + Intergenic
1063337418 10:5229248-5229270 GGGACGGCCCCCGAGGGGGTTGG + Intergenic
1064564280 10:16624355-16624377 TGGGCAGCCACAGAGGTGGAAGG - Intronic
1066471379 10:35701410-35701432 GGGGCTGCTCCGGAGGGGGCAGG - Intergenic
1067416467 10:46106625-46106647 TGGGCGGCCCCGGCGCGGGAGGG - Intergenic
1067436598 10:46283104-46283126 TGGGCGGCCCCCGCGCGGGAGGG - Intergenic
1067572855 10:47384424-47384446 TGGGCGGCCCCGGCAGGGGAGGG + Intergenic
1067937187 10:50623028-50623050 AGGGCTGCCCCCGCGGGGCGGGG - Intronic
1070198098 10:74177188-74177210 TGGGCCGCCCCCGGGGGCGCGGG - Intronic
1072151981 10:92690674-92690696 TGGCCGGCCCCCGTGGGGCAGGG + Intronic
1076110600 10:127856385-127856407 GGGGCTTGGCCCGAGGGGGAAGG - Intergenic
1076358951 10:129873294-129873316 GGGGGTGTCCCCGAGGTGGAAGG - Intronic
1076941823 10:133615197-133615219 TGGGCTGACCTGGATGGGGATGG - Intergenic
1077151670 11:1075602-1075624 TGAGTGGCCCCGGAGGGGGAAGG - Intergenic
1077222017 11:1422025-1422047 TGGGGTGCCCCACGGGGGGAGGG + Intronic
1077305887 11:1868551-1868573 TGGGCTGGCCCTGAGGGGGCTGG + Intronic
1077368275 11:2170058-2170080 TGGGCTGCCCCCATCGGGAAGGG - Intronic
1078093857 11:8284364-8284386 TGGGCTCCTTCCGAAGGGGAGGG - Intergenic
1078571108 11:12458680-12458702 TGGGCTGCCACAGAGGGGGTAGG - Intronic
1080210601 11:29780995-29781017 TGGGCTGACTCTGAGGGGGTAGG - Intergenic
1081825413 11:46046284-46046306 TGTGCTGCCCCATAGGAGGATGG - Intronic
1083333346 11:61909253-61909275 GAGGCTGCACCAGAGGGGGAAGG + Intronic
1083340748 11:61957018-61957040 AGGGCTGCCGCAGAGTGGGAAGG + Intronic
1083679047 11:64342911-64342933 AGGGCTGTTCCCGGGGGGGAGGG + Intronic
1083895156 11:65616175-65616197 TGGCCTCCCCCAGCGGGGGAGGG - Exonic
1084605615 11:70170039-70170061 TGGGATGATCCCCAGGGGGAGGG + Intronic
1084656775 11:70524222-70524244 TGCACTGCCCCCCAGGGGGTGGG - Intronic
1085126173 11:74004177-74004199 TGGGCTGACCCAGAGGTGGGAGG + Intronic
1089178350 11:116564150-116564172 TGGGCTGCCCCCCAGGCAGGTGG + Intergenic
1090013229 11:123062822-123062844 AGGGCTGACCCCGAGGGGCTGGG + Intronic
1091498365 12:991504-991526 CGGGCTGCCGAGGAGGGGGAGGG - Intronic
1092204359 12:6606589-6606611 CGGGCTGCCCCCGAGGAGTGTGG - Intronic
1094499377 12:31008651-31008673 CGGGCTGCCTCCCAGGAGGATGG - Intergenic
1096291988 12:50351320-50351342 AGGGCTGCCCTGGAGTGGGAGGG + Exonic
1104258436 12:127160822-127160844 TGGCCTGCCCCGAAGGGGGAAGG - Intergenic
1104585513 12:130045226-130045248 TGGGCTGCTCAGGAGGGGGCCGG - Intergenic
1104967427 12:132514519-132514541 TGGGGAGACCCCGAGGGGGAAGG + Intronic
1105295579 13:19085856-19085878 AGGGCTGGCCCAGAGGGGAACGG + Intergenic
1113838480 13:113345470-113345492 GGGGCTGCCCTCGATGGAGAGGG - Intronic
1113937437 13:114001864-114001886 AGGGCTGGCCCTGAGGGGGCAGG - Intronic
1116049601 14:39787150-39787172 TGGGCTGCCATTGAGGAGGATGG + Intergenic
1120931408 14:89852449-89852471 TGGGCTGCTCCCCAGGGGAGGGG - Intronic
1120951931 14:90049595-90049617 GGGGCTGCCCCTGATGGGGAGGG + Intergenic
1122408617 14:101514675-101514697 GGGGCTGCCCCTGAGGGGCCTGG - Intergenic
1122552513 14:102557556-102557578 AGGGCTACCCCTGATGGGGAGGG - Intergenic
1122599371 14:102913678-102913700 TGGGCTGCCCCACAGCAGGACGG - Intergenic
1123840699 15:24244351-24244373 TGGGCTGGGCCAGTGGGGGACGG - Intergenic
1125684786 15:41557974-41557996 TGGGCTTCCCCCTGGAGGGAAGG + Intronic
1125685567 15:41561334-41561356 TGGGCTGCCAGCCAGGGGGCAGG + Intronic
1125908035 15:43411635-43411657 TGGGCTGCGCCCAAGGATGAAGG + Intronic
1127761183 15:62140521-62140543 TTGACTGCCCTCAAGGGGGAAGG + Intergenic
1128060526 15:64732678-64732700 TCTGCTGCCCTCAAGGGGGAAGG - Intergenic
1129258845 15:74351293-74351315 TGCGCTGCCCCAAAGCGGGAGGG + Intronic
1129332362 15:74834204-74834226 AGGGCTGGCCCCGTGGGAGAAGG + Intergenic
1130149461 15:81300092-81300114 TGGGCTGCCGCCCTGGGGGAGGG - Exonic
1132055610 15:98648766-98648788 GGAGCTGCCCCCGCGCGGGAGGG - Intergenic
1132299553 15:100767546-100767568 TGGGCTGCCCCCGTGTCGGCTGG + Intergenic
1133224737 16:4335452-4335474 TGGGCAGGTCCCCAGGGGGAGGG + Intronic
1135420482 16:22302667-22302689 TGGGCTGCACCTGCGGGGAAAGG - Intronic
1136318754 16:29468918-29468940 TGGGCTGGCTCCCAGGGTGATGG + Intergenic
1136433326 16:30208262-30208284 TGGGCTGGCTCCCAGGGTGATGG + Intronic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG + Intergenic
1136878763 16:33885482-33885504 TGGGCTTCCCCCGAGCGGTTGGG - Intergenic
1136995905 16:35187934-35187956 TGGGCTTCCCCCTTGGTGGAAGG + Intergenic
1137252362 16:46749371-46749393 AGGGCTGCCCCCAAGGGAGGGGG + Intronic
1138345209 16:56316338-56316360 TGGCCTGCCCACCAGGGGTAGGG + Intronic
1140376944 16:74452302-74452324 TGTGCTGCCCTGGAGGAGGAAGG + Intronic
1141523356 16:84596137-84596159 TGGGCAACCCCAGTGGGGGACGG + Intronic
1142338807 16:89507852-89507874 AGGGCAGCCCCGGAGGAGGAGGG - Intronic
1142405816 16:89889029-89889051 TGGGCAGCCCCAGATGAGGATGG + Intronic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1142594602 17:1023354-1023376 TGGGCTGGCCCTGAGGAAGACGG - Intronic
1142712578 17:1731303-1731325 GGGGCTGCCCAGGAGGGGGTGGG + Intronic
1146376057 17:32295332-32295354 TTGGCTGCACCTGCGGGGGAGGG + Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1147327516 17:39676567-39676589 TGGGATGCTCCCCAGGGGGGAGG - Intronic
1148125380 17:45233884-45233906 AGGCCTGCCCCCGACAGGGAGGG + Intronic
1150324586 17:64246566-64246588 TGGGCTGCCCCCTAGAAGAATGG + Intronic
1152361289 17:79834313-79834335 TGGGCTGCCCCCCAGGCAGGTGG + Exonic
1152420903 17:80192650-80192672 TGGGCTGGCCCAGAGGGTCAAGG - Intronic
1152683278 17:81681067-81681089 TGGACTGCCCCCAAGGCGTATGG - Intergenic
1152701968 17:81823777-81823799 TGCGCTGCCTCCGAGGCGCAGGG - Intronic
1152744914 17:82034103-82034125 TGGGCTTCCCTGGAGGGGGAGGG + Exonic
1153163521 18:2236685-2236707 CGGGCTGCACCAGATGGGGAAGG + Intergenic
1153676418 18:7459858-7459880 GGGGCTGCCCATGAAGGGGAGGG - Intergenic
1154485731 18:14870421-14870443 TGGCCTTCCCCAGAGGGGAAAGG - Intergenic
1157135652 18:45052051-45052073 TGTGCTGCTCACTAGGGGGAAGG + Intronic
1158259027 18:55587859-55587881 GGGGCTGGCGGCGAGGGGGAGGG + Intronic
1158878283 18:61752975-61752997 AGGGCTGCCTCGGAGAGGGAGGG + Intergenic
1159035763 18:63275797-63275819 TGGGGTGCCCACGTGGTGGAGGG + Intronic
1160263105 18:77314493-77314515 TGCCCTGCCCCCCAGGGGGAAGG - Intergenic
1160407920 18:78655441-78655463 TTGGGTGCCACCGTGGGGGATGG + Intergenic
1161076052 19:2286307-2286329 TGTTCTGCCCCCGAAGGGCAGGG + Intronic
1161505487 19:4641177-4641199 TGGGCTGACCCCTGGGGGAACGG - Intronic
1161583042 19:5091155-5091177 CGGGCTGGCCCCGAGGTGGGTGG + Intronic
1166147868 19:40849791-40849813 GGGGGTGCCCAAGAGGGGGAAGG - Intronic
1166170888 19:41027075-41027097 GGGGGTGCCCAAGAGGGGGAAGG - Intergenic
1166178161 19:41089096-41089118 GGGGGTGCCCAAGAGGGGGAAGG + Intronic
1166669014 19:44698644-44698666 TGGGCTGCCCTCGTGGGGCAGGG - Intergenic
1166824771 19:45601991-45602013 GAGGCAGCCCCCGAGGGGGCGGG + Intronic
1167053838 19:47096375-47096397 TGGGCCGCACCCCAGCGGGAAGG - Intronic
1167595191 19:50423722-50423744 GTGGCTGGCCCCGAGGGGAAGGG + Exonic
1167608944 19:50496877-50496899 TGGCCTGGCCTGGAGGGGGAGGG + Intergenic
1168113706 19:54209213-54209235 TGTGCTGGCCCCCAGGGGGGTGG + Intronic
926220972 2:10935230-10935252 TGGCCTGCCCCCGAGATGGCAGG - Intergenic
927151523 2:20198974-20198996 AGGGCTGCCCACAAGGGAGAGGG - Intergenic
927638212 2:24831310-24831332 TGGGTTGGCCCCGATGGTGAAGG - Intronic
927810914 2:26179767-26179789 CAGGCTGCCGCGGAGGGGGATGG + Intronic
928174307 2:29023628-29023650 TGGGCTGCTCCAGTGGGGGTGGG + Intronic
930661034 2:54053403-54053425 TGGGCTGCCACTGAGGGTGCTGG - Intronic
931665911 2:64609453-64609475 TGGGGCGCCCCCGAGCGGGCGGG - Intergenic
934056833 2:88258349-88258371 TGGGCTGCCCTGGAGGGAGAAGG - Intergenic
934754610 2:96816509-96816531 TGGGTGGCCCCGGAGGGGGCGGG + Exonic
934966652 2:98730492-98730514 GGGGCTGCTCCCGAGGGGACCGG - Intronic
938492897 2:131775284-131775306 TGGGCTGCCCACGTGGGGTCTGG + Intergenic
942074374 2:172343160-172343182 TGGGCAGCCCCAGAGAGAGAAGG - Intergenic
945538982 2:211059566-211059588 TGGGCTACCCCCTAAAGGGAAGG - Intergenic
946057472 2:216914666-216914688 TGGGCTGCCCCAGAGGGCACTGG + Intergenic
946396216 2:219444960-219444982 TGGGCTGCCCGGGAGGCGGCGGG - Exonic
947874278 2:233458191-233458213 GGGGCTGACCCCCAGAGGGAGGG + Intronic
947876449 2:233470949-233470971 TGGGCTGCACCTGCGGGGGTGGG + Exonic
948753207 2:240144267-240144289 TGGGCAGCCACCTCGGGGGAGGG + Intronic
948889017 2:240897812-240897834 GGGGCCGCTCCCGAGGGAGAAGG - Intergenic
948920935 2:241065631-241065653 AGCGCTGCCCTCGAGGGGCAGGG - Intronic
1168943975 20:1736053-1736075 TGGGATGCCACCGAGTGAGACGG + Intergenic
1169057406 20:2634972-2634994 TGGCCTAGCCCTGAGGGGGAAGG + Intronic
1169195824 20:3681618-3681640 TGGGCTGCCCCCGAGGGGGAGGG + Intronic
1170013161 20:11750058-11750080 TGTGCTGCCCCAGAGTGTGATGG - Intergenic
1171244855 20:23602956-23602978 TGGGGTTCCCCTGAGGGGCACGG - Exonic
1171896849 20:30815919-30815941 TGGACCGACCCCGAGGGCGAAGG - Intergenic
1172117983 20:32583317-32583339 CGGGCGGCCGCGGAGGGGGAGGG + Intronic
1172184334 20:33021874-33021896 TTGGCAGCCACAGAGGGGGAGGG - Intronic
1173253134 20:41375137-41375159 TGGGCTGCTCTGGAGGGGAAAGG - Intergenic
1175288487 20:57855565-57855587 TGGGATGCCCCCGAGTGAAAAGG - Intergenic
1175487619 20:59356661-59356683 TGGGGTGCCCCACAGGGGCAAGG + Intergenic
1175791951 20:61745471-61745493 TGAGCTGACCCCACGGGGGAAGG + Intronic
1175863202 20:62161088-62161110 TCACCTGCGCCCGAGGGGGACGG + Intronic
1176795596 21:13369048-13369070 TGGCCTTCCCCAGAGGGGAAAGG + Intergenic
1179511801 21:41878756-41878778 TGGGCTGTACCCGAGGGCGGGGG + Exonic
1179590849 21:42406968-42406990 CGGGCTGCCTCTGAGGGGAAGGG + Intronic
1179887313 21:44319691-44319713 TGGGGTGGCCCCGCGGGGGCTGG + Intronic
1180068255 21:45423566-45423588 TGGGCTGACCCCGAGGAGGCTGG - Intronic
1180228421 21:46412069-46412091 TGGGCTCCCCCCGCGGGCCATGG + Intronic
1181653084 22:24271481-24271503 TGGCCGGCGCCCGAGGCGGACGG + Intronic
1183427258 22:37746489-37746511 GGGGCTGCCCCGGAGGGGAGAGG - Intronic
1183903302 22:41022033-41022055 AGGGCTGGGCCGGAGGGGGAGGG + Intergenic
1184029729 22:41885097-41885119 TGGGCAGCACCTGATGGGGAAGG - Intronic
1184161508 22:42700073-42700095 TGGGCTGCTCCCGAGGTAGGGGG + Intronic
1184253303 22:43273100-43273122 TGGGCTGAGACCGAGGAGGAAGG + Intronic
950703556 3:14766558-14766580 GGGGCAGCCGGCGAGGGGGAGGG + Intronic
953730427 3:45442720-45442742 AGGGCTACCCCCGATGGAGAAGG + Intronic
959132149 3:102369358-102369380 TGGGATGCCACAGAGGGGGCAGG + Intronic
961074334 3:123967697-123967719 TGGGCTGCACCTGCAGGGGATGG - Intergenic
961091127 3:124113688-124113710 TGGGCTGCCTCAGAGGGGGCAGG + Intronic
961309295 3:125984438-125984460 TGGGCTGCACCTGCAGGGGATGG + Intergenic
961325337 3:126106080-126106102 TGGGCTGCGAGCGAGGAGGAAGG + Intronic
961584343 3:127909981-127910003 TGGGGTGGCCACGTGGGGGACGG - Intergenic
962712209 3:138097602-138097624 TGGGCTCCCCCGGTGGTGGATGG + Intronic
966591496 3:181688538-181688560 TGGGCTGCCTGCAAGGGTGATGG + Intergenic
966902103 3:184493962-184493984 TGGGCTGAACAAGAGGGGGAAGG - Intronic
968845049 4:3036327-3036349 TGGACTGTCCCCGAGGGGCGGGG + Intronic
968907439 4:3461216-3461238 TGGGCTCCACACGAGGGGCAGGG - Intergenic
969270858 4:6099894-6099916 TGGGATGCTACCGAGGGGCACGG + Intronic
969531380 4:7732957-7732979 TGGGATCCACCAGAGGGGGATGG - Intronic
969674600 4:8607872-8607894 TGGGCTCCTCCGGATGGGGAAGG + Intronic
969714239 4:8860825-8860847 TGTGCAGACCCCGAGGGGTAAGG + Intronic
970008074 4:11429041-11429063 TGGGCGGCACCCGAGCGGGCCGG - Exonic
970332786 4:15002870-15002892 CGCGCCGCCGCCGAGGGGGACGG - Exonic
983877329 4:172892841-172892863 TGGGCTGCCCCTGAGGGAGGAGG - Intronic
983930765 4:173450857-173450879 TGGGCCTCCCCAGAGGGGAAAGG + Intergenic
986449637 5:7851262-7851284 CGGGCTCCTCCCGAGGAGGAAGG - Exonic
995840012 5:116435196-116435218 TGGGATCCACCCGAGGCGGATGG - Intergenic
997470870 5:134115986-134116008 TGCCCTGCTCCCGAGGGGGGTGG - Exonic
999367626 5:151033435-151033457 TGGGCTGCTACCCAGGGGCAGGG - Intronic
1001867326 5:175116866-175116888 TGGGCTGCCCGTGGGAGGGAAGG + Intergenic
1001980063 5:176031719-176031741 TGGCCTTCCCCAGAGGGGAAAGG + Intronic
1001985927 5:176074431-176074453 TGGGCTGACCTTGATGGGGATGG - Intronic
1002230944 5:177763693-177763715 TGGGCTGACCTTGATGGGGATGG + Intronic
1002237319 5:177811944-177811966 TGGCCTTCCCCAGAGGGGAAAGG - Intergenic
1002264394 5:178020055-178020077 TGGGCTGACCTTGATGGGGATGG - Intronic
1002276115 5:178105260-178105282 TGGCCTTCCCCAGAGGGGAAAGG + Intergenic
1002724518 5:181285924-181285946 TGGCCTTCCCCAGAGGGGAAAGG - Intergenic
1004321656 6:14636066-14636088 TTAGCTGGCCCAGAGGGGGAGGG - Intergenic
1004864358 6:19838218-19838240 TGGGCGGACGCCGCGGGGGATGG + Intronic
1005085231 6:21999534-21999556 CAGGCTGCCCCAGAGGGGAATGG - Intergenic
1006580051 6:35071913-35071935 AGGGCAGCCCCAGATGGGGAGGG - Intronic
1014876800 6:126671809-126671831 TGGGCTGCACTCTAGGGGTAAGG + Intergenic
1018906506 6:168079070-168079092 GGCGGTGCCCCCGAGAGGGAGGG - Exonic
1019410456 7:904516-904538 GGGGCTGCCCCCGGGGAGGGAGG - Intronic
1019412366 7:911898-911920 GGGGCTGCCCCTCGGGGGGACGG - Intronic
1019422690 7:958416-958438 TGGGCTTCCCTGGAGGGGGCCGG - Intronic
1019517646 7:1446872-1446894 TGGGCTGCCACCAGGAGGGAGGG - Intronic
1021215713 7:17913132-17913154 GGGACTGCCCCTGAGGGAGAAGG + Intronic
1021998459 7:26202031-26202053 TGCTCTGCCCTCGAGGGGGTAGG + Intronic
1024329163 7:48139440-48139462 TGCCCTGCCCCGAAGGGGGAAGG - Intergenic
1025940843 7:66075598-66075620 TGGGGGGACCCCGACGGGGAAGG - Intergenic
1026817320 7:73522650-73522672 TGTGGTGCGCCGGAGGGGGAGGG + Intergenic
1026903985 7:74052219-74052241 TGGGCTGGCCCTGGAGGGGATGG - Intronic
1027257551 7:76440787-76440809 CTGGCTGCCACCGAGGTGGAAGG - Intronic
1027281297 7:76611255-76611277 CTGGCTGCCACCGAGGTGGAAGG + Intronic
1029458428 7:100682544-100682566 CGGGATGGCCCTGAGGGGGAAGG - Intronic
1029476397 7:100787489-100787511 GGGGATGCCACCGTGGGGGAGGG + Intronic
1032096676 7:128941710-128941732 TGGGCTGCCCCCCAAGAGCAAGG + Intronic
1036702073 8:11019483-11019505 TGGGCTGCCTCCTCTGGGGATGG + Intronic
1037838859 8:22230273-22230295 TGGGCTGCCTCCGAGCGTGTGGG - Intronic
1039945826 8:42128392-42128414 TGGGCTGCCCCCTAGGAGGAAGG - Intergenic
1040072629 8:43200908-43200930 TGGGCTGGCCTCCAGGTGGAGGG - Exonic
1040110938 8:43566958-43566980 TGTGCTGCCCCCGTGGGGAGAGG + Intergenic
1040953470 8:52957774-52957796 TGCGCTGCCCCAGAGGATGAGGG + Intergenic
1042040103 8:64580989-64581011 CCGGCTGACCCCGAGGGGGCAGG + Exonic
1046398032 8:113665802-113665824 TAGGCTGCCCCTGAGAGAGAGGG - Intergenic
1047864294 8:129004843-129004865 TGGCCTGCCTCCCAGGAGGAAGG - Intergenic
1049761676 8:144334486-144334508 TGGGGAGAACCCGAGGGGGAGGG - Intronic
1050839798 9:10134257-10134279 CTGGCTGCCCCCAAGGGAGAAGG + Intronic
1053886656 9:42649297-42649319 TGGCCTTCCCCAGAGGGGAAAGG - Intergenic
1054225675 9:62456747-62456769 TGGCCTTCCCCAGAGGGGAAAGG - Intergenic
1054835724 9:69672790-69672812 TGGGTTGCCACCGAGGAGGGTGG - Intergenic
1060494919 9:124111544-124111566 TGGGCTGCTCCCCTGGAGGAGGG - Intergenic
1061991684 9:134162910-134162932 TGGGGTGACCCCGAGGGGAGGGG + Intergenic
1062066223 9:134527795-134527817 TGGGCAGGCCCCGTGGGGAAAGG + Intergenic
1062408717 9:136410594-136410616 TGGGCCGTCGGCGAGGGGGAGGG + Exonic
1186618540 X:11214658-11214680 TGGGTGGTCCCTGAGGGGGAGGG + Intronic
1187341609 X:18425909-18425931 AGGGCTTCCCCCGAGGGGCTGGG + Intronic
1189749235 X:44202821-44202843 TGGGCTGCCCCTAAGGGAGAGGG + Intronic
1195542323 X:106076530-106076552 TGGGCTTCCTTGGAGGGGGATGG + Intergenic
1196968425 X:121083566-121083588 TGCTCTGCCCCGAAGGGGGAAGG - Intergenic
1196974316 X:121141863-121141885 TGCCCTGCCCCGAAGGGGGAAGG - Intergenic
1197723273 X:129759271-129759293 TTGGGTGCCCCCTTGGGGGAAGG - Intronic
1198807592 X:140505976-140505998 TCCGATGCCCCTGAGGGGGAGGG + Intergenic