ID: 1169195988

View in Genome Browser
Species Human (GRCh38)
Location 20:3682179-3682201
Sequence AGCCTGGCCAGGGGCCCCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 359}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169195964_1169195988 26 Left 1169195964 20:3682130-3682152 CCACCGCCCGCCCTCGCTCCCGC 0: 1
1: 0
2: 14
3: 185
4: 1458
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195966_1169195988 20 Left 1169195966 20:3682136-3682158 CCCGCCCTCGCTCCCGCCTCCCC 0: 1
1: 3
2: 12
3: 236
4: 2531
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195978_1169195988 -5 Left 1169195978 20:3682161-3682183 CCCGCCAACCCCGCTCGGAGCCT 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195972_1169195988 4 Left 1169195972 20:3682152-3682174 CCTCCCCTCCCCGCCAACCCCGC 0: 1
1: 1
2: 21
3: 389
4: 3462
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195963_1169195988 27 Left 1169195963 20:3682129-3682151 CCCACCGCCCGCCCTCGCTCCCG 0: 1
1: 2
2: 5
3: 46
4: 773
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195970_1169195988 8 Left 1169195970 20:3682148-3682170 CCCGCCTCCCCTCCCCGCCAACC 0: 1
1: 0
2: 15
3: 182
4: 1493
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195968_1169195988 16 Left 1169195968 20:3682140-3682162 CCCTCGCTCCCGCCTCCCCTCCC 0: 1
1: 0
2: 34
3: 940
4: 9459
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195969_1169195988 15 Left 1169195969 20:3682141-3682163 CCTCGCTCCCGCCTCCCCTCCCC 0: 1
1: 0
2: 52
3: 537
4: 5033
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195967_1169195988 19 Left 1169195967 20:3682137-3682159 CCGCCCTCGCTCCCGCCTCCCCT 0: 1
1: 2
2: 25
3: 787
4: 9129
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195974_1169195988 0 Left 1169195974 20:3682156-3682178 CCCTCCCCGCCAACCCCGCTCGG 0: 1
1: 0
2: 3
3: 17
4: 232
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195981_1169195988 -9 Left 1169195981 20:3682165-3682187 CCAACCCCGCTCGGAGCCTGGCC 0: 1
1: 0
2: 1
3: 12
4: 184
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195962_1169195988 30 Left 1169195962 20:3682126-3682148 CCTCCCACCGCCCGCCCTCGCTC 0: 1
1: 1
2: 7
3: 101
4: 956
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195971_1169195988 7 Left 1169195971 20:3682149-3682171 CCGCCTCCCCTCCCCGCCAACCC 0: 1
1: 1
2: 37
3: 424
4: 3383
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195973_1169195988 1 Left 1169195973 20:3682155-3682177 CCCCTCCCCGCCAACCCCGCTCG 0: 1
1: 0
2: 5
3: 25
4: 386
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195976_1169195988 -1 Left 1169195976 20:3682157-3682179 CCTCCCCGCCAACCCCGCTCGGA 0: 1
1: 0
2: 1
3: 19
4: 187
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195965_1169195988 23 Left 1169195965 20:3682133-3682155 CCGCCCGCCCTCGCTCCCGCCTC 0: 1
1: 0
2: 17
3: 270
4: 2531
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195977_1169195988 -4 Left 1169195977 20:3682160-3682182 CCCCGCCAACCCCGCTCGGAGCC 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359
1169195979_1169195988 -6 Left 1169195979 20:3682162-3682184 CCGCCAACCCCGCTCGGAGCCTG 0: 1
1: 0
2: 0
3: 16
4: 169
Right 1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG 0: 1
1: 1
2: 3
3: 33
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169195988 Original CRISPR AGCCTGGCCAGGGGCCCCGA CGG Exonic