ID: 1169196832

View in Genome Browser
Species Human (GRCh38)
Location 20:3687736-3687758
Sequence CTCAGGGATGAGCTCACAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169196828_1169196832 -5 Left 1169196828 20:3687718-3687740 CCCAACAATGTCAAAAGTCTCAG 0: 1
1: 0
2: 0
3: 11
4: 223
Right 1169196832 20:3687736-3687758 CTCAGGGATGAGCTCACAGTTGG 0: 1
1: 0
2: 2
3: 27
4: 258
1169196829_1169196832 -6 Left 1169196829 20:3687719-3687741 CCAACAATGTCAAAAGTCTCAGG 0: 1
1: 0
2: 3
3: 14
4: 189
Right 1169196832 20:3687736-3687758 CTCAGGGATGAGCTCACAGTTGG 0: 1
1: 0
2: 2
3: 27
4: 258
1169196827_1169196832 10 Left 1169196827 20:3687703-3687725 CCTGCTGGTGGCATTCCCAACAA 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1169196832 20:3687736-3687758 CTCAGGGATGAGCTCACAGTTGG 0: 1
1: 0
2: 2
3: 27
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169196832 Original CRISPR CTCAGGGATGAGCTCACAGT TGG Exonic
900114792 1:1023904-1023926 CTCAGGGACGAGCTCCAGGTGGG + Intronic
900265079 1:1753288-1753310 CTCAGGGGTGAGGTCCCAGGAGG + Intronic
900330812 1:2133597-2133619 CCGAGGGATGAGCGCACAGCCGG - Intronic
900908924 1:5580373-5580395 CTCAGGATTGAGCACACAGAGGG + Intergenic
901759632 1:11462288-11462310 CACAGGGCTCAGCACACAGTAGG + Intergenic
901759666 1:11462481-11462503 CACAGGGCTCAGCACACAGTAGG + Intergenic
901989437 1:13100802-13100824 CTCAGGGATCTTCCCACAGTGGG + Intergenic
901992376 1:13125962-13125984 CTCAGGGATCTTCCCACAGTGGG - Intergenic
902954884 1:19918810-19918832 CACAGGGCAAAGCTCACAGTTGG - Intergenic
903181129 1:21605485-21605507 CCCAGGGCTGCGCACACAGTAGG + Intronic
903376991 1:22872881-22872903 CTCAGGCATAAGCACACAGGGGG - Intronic
903461675 1:23525017-23525039 CCCAGGGAGGTGCCCACAGTGGG + Intronic
903564761 1:24256587-24256609 CATAGGGCTGAGCACACAGTAGG + Intergenic
904081158 1:27873262-27873284 CACAGGGATGGGCACACAGCAGG + Intronic
904307691 1:29600692-29600714 TTCAGGGATGGGCTGAGAGTAGG + Intergenic
904420699 1:30389387-30389409 CTCAGGCCTGAGGTCACTGTTGG + Intergenic
910275435 1:85444674-85444696 CACAGTGAGGAGCACACAGTAGG - Intronic
916368352 1:164060332-164060354 CTTAGGGATGAGCTAAGAGAAGG - Intergenic
917039706 1:170791129-170791151 CTAAGGGATAATGTCACAGTGGG + Intergenic
918056356 1:181025084-181025106 CTCAGTGCTTAGCACACAGTAGG - Intergenic
921791658 1:219297138-219297160 CTTAGGAATGAGCTCACAATTGG + Intergenic
921937251 1:220806694-220806716 CTCAGGGGTGAGGTGACAGCGGG - Intronic
1064768003 10:18694837-18694859 CTCAGGGAAGATCTCTCTGTCGG + Intergenic
1065612879 10:27489663-27489685 ATCAGGGAGGAGCACACAGGGGG + Intergenic
1065793877 10:29288817-29288839 CTCAGAGAAGAGCTCTCACTTGG + Intergenic
1067197429 10:44134273-44134295 CTCCAGGTTGAGCTCAGAGTGGG + Intergenic
1067991491 10:51218360-51218382 CTCAACTATGAGATCACAGTTGG + Intronic
1069776843 10:70932270-70932292 CTCTGGGCCGAGCACACAGTAGG - Intergenic
1070073072 10:73108394-73108416 ATCAGAGATGAGATCAGAGTAGG - Intergenic
1070513025 10:77178298-77178320 CCCAGTGCTGAGCACACAGTAGG + Intronic
1070754129 10:78981276-78981298 CTCAGTGCTCAGCACACAGTAGG + Intergenic
1070819062 10:79344183-79344205 CTCAGGGCTCAGAACACAGTAGG + Intergenic
1073058807 10:100720340-100720362 TTTGGGGATGAGCCCACAGTGGG + Intergenic
1073445883 10:103580057-103580079 CCCAGGGCTGGGCACACAGTAGG + Intronic
1073661082 10:105477003-105477025 CTCTGTGCTCAGCTCACAGTTGG + Intergenic
1075625507 10:123961631-123961653 CACAGGCATGAGCTCCAAGTTGG + Intergenic
1075658874 10:124179743-124179765 CTCAGGGATGACCCCATAGGTGG + Intergenic
1076599087 10:131645654-131645676 CTCAGGGATGACACCACAATAGG - Intergenic
1076632380 10:131858809-131858831 CTCTGCGATGAGCAAACAGTTGG - Intergenic
1077140090 11:1020458-1020480 CCCACGGATGAGCACAGAGTGGG - Intronic
1077434330 11:2531527-2531549 CCCAGGGATGCGCAGACAGTGGG - Intronic
1078441753 11:11373908-11373930 CTCAGGGATGAGAAAACTGTCGG + Intronic
1078906477 11:15692706-15692728 CTCAGAGGTGAGCTCAGAGGAGG - Intergenic
1079338238 11:19589930-19589952 CTCAGCCCTGAGCTCACCGTGGG + Intronic
1080418947 11:32093452-32093474 CTCCTGAATGTGCTCACAGTAGG - Intronic
1083272091 11:61577754-61577776 CCCAGGGACAAGCTCACAGAGGG + Intronic
1084174635 11:67416862-67416884 CCCAGGGCTGGGCACACAGTAGG + Intronic
1084334748 11:68450141-68450163 CGCAGGGATGGGCCCACAGCAGG - Intergenic
1084706580 11:70819441-70819463 CCCAGGGATCAGCTCATTGTCGG - Intronic
1085281377 11:75333297-75333319 CTCTGGCAGGAGCACACAGTAGG + Intronic
1085706820 11:78794058-78794080 CTGATGGATGAGCAGACAGTTGG - Intronic
1086089865 11:82994484-82994506 CACAGGGATGAGATCAGAATTGG + Intronic
1086553917 11:88087246-88087268 CTCAGGGAAGAGACCACACTTGG + Intergenic
1087397492 11:97619443-97619465 CTCAGGAAAGAGCACACTGTGGG - Intergenic
1087465148 11:98494969-98494991 CCCAGGAAACAGCTCACAGTAGG - Intergenic
1087810162 11:102601623-102601645 CTCAGGGAAGAGGTCACAGTTGG - Intronic
1089098146 11:115936959-115936981 CACAGTGATGAGCACATAGTAGG + Intergenic
1089646938 11:119886642-119886664 CTGGGAGATGAGCTCTCAGTTGG + Intergenic
1089778170 11:120853882-120853904 CCCAGTGCTGAGCACACAGTAGG + Intronic
1090321188 11:125844973-125844995 CTCTGGGATGAGCCCCTAGTGGG + Intergenic
1090464829 11:126924764-126924786 GGCAGGGATGAGCACACAGCAGG - Intronic
1091023917 11:132125130-132125152 CAAACGGATGGGCTCACAGTGGG + Intronic
1091214942 11:133895150-133895172 CTCGGGGATGAGCTGAGAGCTGG + Intergenic
1093514161 12:19965988-19966010 CTCAGAGATGAGCTTATAGTAGG + Intergenic
1094151754 12:27292614-27292636 CAAAGTGATGAGCACACAGTAGG - Intronic
1098497541 12:71153686-71153708 CTCAGCTCTGAGCTCTCAGTTGG - Intronic
1098666667 12:73171707-73171729 GTCAGGCAGGAGTTCACAGTAGG - Intergenic
1099336388 12:81365040-81365062 CTCAGGGAAGAGGACCCAGTAGG + Intronic
1099437253 12:82659455-82659477 ATCAGGGATGAGCTCCCTCTGGG - Intergenic
1099495826 12:83344612-83344634 GTCAAAAATGAGCTCACAGTAGG - Intergenic
1100016386 12:90015703-90015725 GTCAGGCATGAGCTCAGTGTGGG + Intergenic
1101827141 12:108229210-108229232 ATCAGGGCTTAGCACACAGTAGG - Intronic
1102526333 12:113514942-113514964 CTCAGGGACCAGCGCACAGAGGG + Intergenic
1103805462 12:123569102-123569124 CTCTGGGATGGGCTCGGAGTCGG - Intergenic
1104247033 12:127053538-127053560 CTCAGGGATGAGCACCTAGCTGG - Intergenic
1104592864 12:130098695-130098717 TTCAGAGCTGAGCTCACAGCAGG + Intergenic
1104668731 12:130666539-130666561 CACAGGATTGAGCTCACAGCAGG - Intronic
1105329375 13:19400823-19400845 CTCAGGGAAGAGGTCAGAGTTGG + Intergenic
1105487594 13:20852004-20852026 CTCAGGAATGAGCACATACTTGG - Intronic
1105810290 13:23989586-23989608 CAGAGGGATGAGTTCAGAGTGGG - Intronic
1107565624 13:41601021-41601043 CTCAGGCATGAGCTGAGAGCTGG - Intronic
1108021536 13:46132772-46132794 ATCTGTGATGAGCTCACAGCAGG + Intronic
1108703447 13:52963545-52963567 CTGATGCATGAGCTCATAGTGGG - Intergenic
1113424602 13:110197680-110197702 CTCATGGATGAGGCCACTGTTGG - Intronic
1117404247 14:55386520-55386542 CCCAGGGATAATCTCACAGCAGG + Intronic
1121787143 14:96670624-96670646 CTCAGGCTTGAACTCACAGTGGG - Intergenic
1121798609 14:96755383-96755405 CTCAGGGCTGGGCACACGGTAGG - Intergenic
1122785088 14:104159866-104159888 CTCAGGGGTGAGATCAGAGGGGG + Intronic
1123142374 14:106093953-106093975 CCCAGGGCTGAGCACACAGAGGG + Intergenic
1123149695 14:106169156-106169178 CCCAGGGCTGAGCACACAGAGGG + Intergenic
1123217912 14:106829905-106829927 CCCAGGGCTGAGCACACAGTGGG + Intergenic
1123223449 14:106878025-106878047 CCCAGGGCTGAGCACACAGAAGG + Intergenic
1124809159 15:32917083-32917105 CTCAAGGATGACCTCATTGTTGG - Intronic
1126373391 15:47970485-47970507 GTCAGGGTTGAGGACACAGTGGG + Intergenic
1126738077 15:51751690-51751712 CTCCGGGATGAGCGCACGGACGG + Exonic
1128667354 15:69548184-69548206 CCAAGGGCTGAGCTCCCAGTGGG + Intergenic
1129295685 15:74598812-74598834 CTCAGGGAGGAGCTTCCAGGAGG + Intronic
1131469835 15:92687180-92687202 CCCTGGGATGAGCTAGCAGTTGG - Intronic
1131702552 15:94954984-94955006 GTCAGGGATGGGCACAAAGTAGG - Intergenic
1132626337 16:893455-893477 CTCCAGGATGAGCCCAAAGTCGG + Intronic
1132663361 16:1071187-1071209 CGCAGGGCTGAGCTCCCACTGGG + Intergenic
1133454212 16:5928975-5928997 CTTAGGGACCAGCTCACAGCTGG - Intergenic
1134343915 16:13371733-13371755 CTCCCCGTTGAGCTCACAGTTGG - Intergenic
1138351839 16:56350149-56350171 CCCAGGGGTGAGCACACCGTGGG - Intronic
1139263242 16:65615888-65615910 GTCAGGGATGAGCTCTAAGAAGG + Intergenic
1139954828 16:70688119-70688141 GTCAGGGATCAGCTCACAGGGGG + Intronic
1141678661 16:85531210-85531232 CTCAGAGCTGTGCCCACAGTGGG - Intergenic
1141894705 16:86951928-86951950 CCCAGGGATCAGAGCACAGTGGG - Intergenic
1142349563 16:89573928-89573950 CTCAGGGATCAGCCCGCAGTAGG - Intergenic
1142972629 17:3623148-3623170 CTCAGGGCTGTGCTTACACTGGG + Intronic
1143803244 17:9402920-9402942 GTCTGCTATGAGCTCACAGTTGG - Intronic
1144768278 17:17744951-17744973 CTCGGGGTTCAGCACACAGTAGG - Intronic
1145808753 17:27752477-27752499 CCCAGGAATCAGCCCACAGTAGG + Intergenic
1145911871 17:28547832-28547854 CTCAGGGTGGAGTTCACAGTGGG - Exonic
1146603048 17:34235130-34235152 CACAGGGCTGTGCACACAGTAGG + Intergenic
1147598486 17:41731950-41731972 CACAGGGATGAGCACACTGCAGG + Exonic
1148216752 17:45837542-45837564 CACAGTGCTGAGCACACAGTAGG - Intergenic
1150486887 17:65550256-65550278 CTCATGGCAGAGCTCACAGGTGG - Intronic
1150820202 17:68428553-68428575 CACAGCCCTGAGCTCACAGTGGG - Intronic
1151255495 17:72873322-72873344 CTCAGGGATGAAATCACAGAGGG - Intronic
1151395954 17:73823149-73823171 GTCAGGGATTTGCTCAGAGTTGG + Intergenic
1152572057 17:81125210-81125232 CTCAGGGTTGGGCACAGAGTAGG - Intronic
1157310992 18:46553039-46553061 CTCAGGGTTGACCTCAGAGGAGG - Intronic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1161584797 19:5099596-5099618 CTCAGAAATGAGGTCACAGCAGG - Intronic
1162537033 19:11268824-11268846 GTCAGTGGTGAGCTCAGAGTAGG + Intergenic
1163031655 19:14548414-14548436 CTAAGGGATGTGCTGACATTTGG - Intronic
1164869632 19:31632070-31632092 AGCAGGGATCAGATCACAGTGGG + Intergenic
1165099272 19:33428784-33428806 CACAGTGATGAGCACACAGTAGG + Intronic
1165793283 19:38504996-38505018 CTCCGGGATGATCACACTGTTGG - Exonic
1166194539 19:41197323-41197345 CCCAGGGATGAGGACTCAGTAGG - Intronic
1166305954 19:41937191-41937213 CTGATGTATGAGCTCACACTGGG + Intergenic
1167020692 19:46873212-46873234 CTCTGGGCTGAGATCACACTGGG - Intergenic
1167068319 19:47203940-47203962 CTCTGTGCTTAGCTCACAGTTGG + Intronic
1167633900 19:50642290-50642312 CTCAGAGATGGGCACACAGATGG + Intronic
1167733166 19:51273783-51273805 CTCATGTATGATCTCACAGAAGG + Intergenic
1168123212 19:54266548-54266570 CTCAGGGATAGGCTCATGGTAGG + Intronic
925923899 2:8657251-8657273 CTCAGGGCTGAGCTCAGGGTGGG - Intergenic
926859230 2:17291544-17291566 CTGAGGGATGAACTCTCACTGGG - Intergenic
929678072 2:43958169-43958191 GCAAGGGATGAGATCACAGTAGG + Intronic
932189275 2:69725664-69725686 CTCAGAGAAGAGCAAACAGTGGG + Intronic
933051656 2:77609778-77609800 CTCTGGGATGAGTTCCCAGAGGG + Intergenic
933537637 2:83596703-83596725 CTCAGGAATAAGCTGACAGTTGG - Intergenic
934513026 2:94963357-94963379 CCCAGGGATGAGCACACAGGAGG + Intergenic
934527177 2:95059217-95059239 CTGAGGGAGGAGCTCCCAGAGGG + Intergenic
935036329 2:99378096-99378118 GCCAGGGATGAGCACAAAGTAGG - Intronic
935606753 2:104979320-104979342 CCCAGAGATGAGATCACAGAGGG - Intergenic
938320445 2:130359055-130359077 CTCTGGGAGGAGAGCACAGTGGG - Intronic
939632839 2:144546137-144546159 CTCAGAGATGATCTAACAGAGGG - Intergenic
939639851 2:144627342-144627364 TTCATGGACGTGCTCACAGTGGG - Intergenic
942631389 2:177953746-177953768 CTCAGGGATGAACTCACCAAGGG - Intronic
946163677 2:217850777-217850799 CCCAGGCATGAGCACACACTAGG + Intronic
947093921 2:226544852-226544874 GTCAGGGATGAAATCACAGGGGG - Intergenic
948115513 2:235492543-235492565 TTCAGGGGTGAGGTCACAGCTGG + Intergenic
949026324 2:241768043-241768065 CTGAGGGATGAGCCGGCAGTGGG + Exonic
1168834841 20:871273-871295 CTCAGGGATCGGCTGAGAGTGGG + Exonic
1168877189 20:1180081-1180103 CTCAGGGAAGAGCTCCCTGGTGG - Intronic
1168924227 20:1566304-1566326 CCCTGGGATGAGCTCCCAGGTGG - Intronic
1169196832 20:3687736-3687758 CTCAGGGATGAGCTCACAGTTGG + Exonic
1171113513 20:22504747-22504769 CACAGGGCAGAGCTCACAGGTGG + Intergenic
1172134802 20:32679758-32679780 CTCTGGGATAAGCTTACAGAAGG - Intergenic
1172314051 20:33939872-33939894 CTCAGGCATGGGCTCCCAGCAGG + Intergenic
1172939411 20:38644305-38644327 CTCAGGGCAAAGCTCACGGTGGG - Intronic
1173596992 20:44264861-44264883 ATCAGGGCTTAGCACACAGTAGG + Intronic
1173912466 20:46680530-46680552 TCCAGGGATCAACTCACAGTAGG + Intronic
1175938479 20:62526161-62526183 CTCAGGGAAGAACTTTCAGTGGG + Intergenic
1176290251 21:5040139-5040161 ATCACGTGTGAGCTCACAGTGGG - Intronic
1179867004 21:44223502-44223524 ATCACGTGTGAGCTCACAGTGGG + Intronic
1179930414 21:44567833-44567855 TTCAGGGAAGAGGTCACACTGGG + Exonic
1180205228 21:46255670-46255692 CTCAGGGAAGAGGCCTCAGTTGG + Intronic
1182577964 22:31286172-31286194 ATCAGGGAAGAGCATACAGTAGG + Intronic
1184272625 22:43393343-43393365 CACAGGGATGACCTCACCGGGGG - Intergenic
1184289746 22:43492300-43492322 CTGCAAGATGAGCTCACAGTTGG + Intronic
1184799342 22:46750502-46750524 CTCAGGGAGGGGCCCACAGGAGG + Intergenic
1184915596 22:47566767-47566789 CTCAGGGATGTGTTTCCAGTGGG + Intergenic
1185367159 22:50441964-50441986 CTGAGGCCTGAGCTCCCAGTAGG + Intronic
949216618 3:1577417-1577439 CTCAGGGCTGAGCACACACCTGG + Intergenic
949530147 3:4947581-4947603 CTCAAGGTTTTGCTCACAGTTGG - Intergenic
952446255 3:33383996-33384018 ATCTGTGATGAGTTCACAGTGGG - Exonic
952827687 3:37537799-37537821 CTCCTGGAGGAGCCCACAGTCGG - Intronic
954639720 3:52090766-52090788 CCCAGGGATGGGCGCTCAGTAGG - Intronic
955063278 3:55513032-55513054 GCCAGGGATCATCTCACAGTGGG - Intronic
957686610 3:83510541-83510563 CTTAAGGTTGTGCTCACAGTAGG - Intergenic
958731846 3:97968240-97968262 TTCAGGAATAAGCTCAGAGTTGG - Intronic
958935184 3:100249138-100249160 CTGATGGATGAGGTCACAGATGG + Intergenic
959484711 3:106913529-106913551 CTGAGGTATGGGCTCACAGAAGG - Intergenic
963432038 3:145219802-145219824 CTCAGAAATAAGCTCACATTAGG - Intergenic
963693505 3:148535350-148535372 CCCAGGAATGAGCTCTGAGTTGG + Intergenic
963820776 3:149890312-149890334 CTCAGTCAAGAGTTCACAGTAGG - Intronic
964242811 3:154616306-154616328 CTCAGGGATGTGCCCACTGTAGG - Intergenic
964698751 3:159539659-159539681 CTCAGTAATGATCTCACAATAGG + Intronic
966205307 3:177400090-177400112 TCCAGGGTTGAGCTCTCAGTTGG + Intergenic
966457158 3:180130324-180130346 CGTAGGGATGTGCTCACTGTTGG - Intergenic
967852710 3:194094080-194094102 CCCAGGGATGAGCTGACTGTGGG - Intergenic
968040359 3:195583609-195583631 CGCTGGGATGAGTTCACACTGGG + Intronic
969396275 4:6923661-6923683 CTCGGGGATGAGGTCGGAGTCGG - Exonic
969489036 4:7488402-7488424 CTGAGGGATGAGGTCAGAGAAGG + Intronic
969718952 4:8882504-8882526 CTCAGGGCTCTGCGCACAGTAGG + Intergenic
969870037 4:10098862-10098884 GTGAGGGTTGAGCTCCCAGTAGG - Intronic
970378338 4:15480868-15480890 CTCTGTGCTGAGCTCACAGTAGG - Intronic
970467111 4:16335543-16335565 CTCAGGGCTTGGCTCATAGTTGG + Intergenic
971315023 4:25560459-25560481 GTCTGGGATGAGGACACAGTGGG + Intergenic
971641751 4:29142953-29142975 TCCAGGAATGAGCTCACAGTGGG + Intergenic
973736032 4:53872470-53872492 CTCAGTGATGGGCACACAGTTGG + Intronic
975759122 4:77600746-77600768 CTCTGGCATGAGATCACATTCGG - Intronic
979397039 4:120201384-120201406 CTCATGAATGAGCAAACAGTAGG + Intergenic
979745008 4:124201930-124201952 CTTAGGAATGAGCTAAAAGTAGG + Intergenic
981689108 4:147486769-147486791 CTCAGGGGTGGGCACACAGTGGG - Intronic
984525270 4:180850557-180850579 CTCAGGGAGTAGCTCACGCTGGG + Intergenic
985962407 5:3312460-3312482 CTCAGGGATTAACTCAATGTGGG - Intergenic
986758472 5:10858775-10858797 CTCAGGTATGAGTCCACAGGGGG + Intergenic
991112925 5:62922063-62922085 TTCAAGGTTGAGCTGACAGTTGG + Intergenic
992213798 5:74506356-74506378 CACAGGGCTTAGCACACAGTAGG - Intergenic
995372209 5:111431211-111431233 GTCAGAGATGAGTTCACTGTAGG - Intronic
996773492 5:127109599-127109621 CTCTGGCATCAGCTGACAGTGGG - Intergenic
996803106 5:127425499-127425521 GTGAGGGATGACCTCACAGCAGG - Intronic
997228852 5:132228465-132228487 CCCAGGGCCGAGCTCTCAGTGGG + Intronic
997370397 5:133356222-133356244 CCCAGGGCTTAGCACACAGTGGG - Intronic
997668411 5:135650616-135650638 GCCAGGGCTGAGCTAACAGTAGG - Intergenic
998415830 5:141945584-141945606 CTCGGAGATGAGCTCACTGCTGG - Exonic
999270979 5:150296259-150296281 GGCAGGTATGAGCTCACGGTCGG - Intergenic
999446637 5:151645696-151645718 CACAGTGCTGAGCACACAGTAGG - Intergenic
1000170192 5:158694634-158694656 CTCAAGTATGAGCTCCAAGTGGG + Intergenic
1000975967 5:167764775-167764797 CTCAGGGGAGAGCTCCCCGTGGG - Intronic
1001679199 5:173543864-173543886 CTCTGGGAGCAGCTCACAGAGGG + Intergenic
1002818714 6:702301-702323 TTCAAAGATGAGCTCACAGGAGG - Intergenic
1006579496 6:35068633-35068655 CTCAGGGATCAGGGCACTGTGGG - Intronic
1006719740 6:36142533-36142555 CACAGGTATTTGCTCACAGTGGG - Intronic
1009202206 6:60759642-60759664 CTCAGGGATAACCTCTCATTGGG + Intergenic
1009696249 6:67107710-67107732 GTCAAGAATGAGCTCACTGTAGG - Intergenic
1014331744 6:120076222-120076244 ATCAGGGATGAGCACACACAAGG + Intergenic
1015040809 6:128716600-128716622 CTAAAGGATGAGTTGACAGTGGG - Intergenic
1016001069 6:139041845-139041867 CACAGTGCTGCGCTCACAGTAGG + Intronic
1017745674 6:157444842-157444864 CTCAAGGATGAGACCAAAGTGGG + Intronic
1018635820 6:165858461-165858483 CTCAGTGTTGAAGTCACAGTTGG - Intronic
1018911774 6:168105162-168105184 CTCACTGGTGAGCTGACAGTGGG - Intergenic
1019078594 6:169411815-169411837 CTGTGGGAAGAGCTCACACTGGG - Intergenic
1019078617 6:169411941-169411963 CTCTGGGAAGAGCTCACACCAGG - Intergenic
1019281611 7:203154-203176 CAGAGGGATCAGCTCTCAGTGGG + Intronic
1023900875 7:44477605-44477627 CTCTTGGATGACCTCACGGTAGG - Intronic
1024273832 7:47661367-47661389 TTCAGGGATCAGCTCACAGCAGG + Exonic
1025956655 7:66188214-66188236 CTTAGGAATGGGCTCTCAGTTGG - Intergenic
1029030116 7:97458354-97458376 CTCAGAGAGGAGCTGACATTTGG - Intergenic
1029916990 7:104220517-104220539 GTCAGGGATGAAATCACAGGGGG + Intergenic
1030201083 7:106905229-106905251 ATCCGGGATGCCCTCACAGTGGG + Exonic
1031980873 7:128123549-128123571 GCCAGGGATGGGCTCACAGAGGG + Intergenic
1032003448 7:128281778-128281800 CTGAGGGAGGAGACCACAGTTGG + Intergenic
1032474243 7:132201613-132201635 CTCAGGGCTGAGCACACAGTAGG - Intronic
1032488848 7:132308859-132308881 ATCAGGGTTGTGCTCTCAGTGGG - Intronic
1033038271 7:137895217-137895239 CTCAGGGATGAGACCAGGGTGGG + Intronic
1033048849 7:137986119-137986141 CTCAGAAAGGTGCTCACAGTAGG + Intronic
1034050694 7:147981237-147981259 CTCAGGGATGAGAGTACAGTTGG - Intronic
1034629424 7:152519643-152519665 CTCAAGGCTGAGCACACAGCAGG - Intergenic
1035037127 7:155902725-155902747 CTCAGAACTGAGCTCACAGCAGG - Intergenic
1035314694 7:157990621-157990643 CTCAGGGCGGTGCTGACAGTAGG + Intronic
1035659095 8:1333420-1333442 GTCAGGGACGAGATCACAGTTGG - Intergenic
1037764400 8:21763427-21763449 CTCAGGAATGACCTCACACCTGG + Intronic
1037921670 8:22810603-22810625 CTCAGAGCTGAGTTCAGAGTTGG + Intronic
1038321625 8:26532221-26532243 CCCAGGGATGAGGTCAGAGTTGG + Intronic
1038678367 8:29644056-29644078 CTCAGGGATAAGCAGACACTGGG + Intergenic
1039072567 8:33660071-33660093 CTCAGCTCTGAGCTCACAGCTGG - Intergenic
1040816709 8:51515377-51515399 ATCAGGTATGTGTTCACAGTGGG - Intronic
1043827706 8:84949062-84949084 CTCGGAGATGAGCACACTGTAGG - Intergenic
1044520511 8:93194045-93194067 CTGACGGACTAGCTCACAGTAGG - Intergenic
1046679881 8:117156882-117156904 CTCTGGGATTAGCTTAAAGTGGG + Intronic
1047816772 8:128473351-128473373 CTCAGAGATGACCTGAGAGTAGG - Intergenic
1048180414 8:132189278-132189300 CCCAGGGATGAGATCACACAAGG - Intronic
1048870564 8:138793772-138793794 CTCTGGGGTGAGCTCACAGCGGG - Intronic
1048935035 8:139347964-139347986 ATCAGGGATGAGGTCATATTGGG + Intergenic
1051343239 9:16130064-16130086 CTGGGGAGTGAGCTCACAGTTGG - Intergenic
1054713848 9:68537959-68537981 TTCAGGGATCAGCACAGAGTTGG - Intronic
1055690063 9:78820524-78820546 ATCAGAGCTGAGCTCACACTGGG - Intergenic
1056552451 9:87663421-87663443 ATCAGGGAGGGGCTCACAGTGGG - Intronic
1058053454 9:100427741-100427763 CACAGTGATCAGCACACAGTGGG - Intronic
1060522421 9:124301236-124301258 CTCAGGACTGGGCACACAGTGGG + Intronic
1061494179 9:130962333-130962355 ATCAGGGGTGAGCTGAGAGTAGG + Intergenic
1061729470 9:132602408-132602430 CTCAGTGCTGATCTCAGAGTGGG - Intronic
1062263715 9:135676986-135677008 CACAGGGACGAGATGACAGTGGG - Intergenic
1185599531 X:1329409-1329431 CTCAGGGTTGAGCTCCCTCTGGG - Intergenic
1186068073 X:5787931-5787953 CACTGGGAAGAGCTCACAGTGGG - Intergenic
1187626044 X:21115078-21115100 CACAGGGATGAGCTAACACTAGG - Intergenic
1192538040 X:71945429-71945451 CTCAGGAAGGAACTCACACTGGG - Intergenic
1192725100 X:73741680-73741702 CTCAGGGCTGAAGTCATAGTGGG - Intergenic
1193962169 X:87939748-87939770 CTAAGGGATGAGCTCCCTCTGGG - Intergenic
1196704215 X:118702847-118702869 CTCAGGGGTGAGTTCTCAGCTGG - Intergenic
1197700106 X:129593268-129593290 ATCAGGGTCAAGCTCACAGTTGG - Intergenic
1201924489 Y:19269752-19269774 CTCAGGGATTAGCACAGATTAGG + Intergenic
1202602520 Y:26608773-26608795 CTCAGGGAAGAGGTCAGAATTGG - Intergenic