ID: 1169198748

View in Genome Browser
Species Human (GRCh38)
Location 20:3697434-3697456
Sequence CAACCCTGTGGGCACCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 192}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169198748_1169198757 4 Left 1169198748 20:3697434-3697456 CCCCTGGGGTGCCCACAGGGTTG 0: 1
1: 0
2: 2
3: 35
4: 192
Right 1169198757 20:3697461-3697483 GAAAAGCAAGCTAGCTCACAGGG 0: 1
1: 0
2: 0
3: 16
4: 240
1169198748_1169198762 29 Left 1169198748 20:3697434-3697456 CCCCTGGGGTGCCCACAGGGTTG 0: 1
1: 0
2: 2
3: 35
4: 192
Right 1169198762 20:3697486-3697508 GCCTAGGAGAAGTGGGCCCTGGG 0: 1
1: 1
2: 6
3: 55
4: 272
1169198748_1169198760 22 Left 1169198748 20:3697434-3697456 CCCCTGGGGTGCCCACAGGGTTG 0: 1
1: 0
2: 2
3: 35
4: 192
Right 1169198760 20:3697479-3697501 CAGGGCAGCCTAGGAGAAGTGGG 0: 1
1: 0
2: 3
3: 32
4: 280
1169198748_1169198764 30 Left 1169198748 20:3697434-3697456 CCCCTGGGGTGCCCACAGGGTTG 0: 1
1: 0
2: 2
3: 35
4: 192
Right 1169198764 20:3697487-3697509 CCTAGGAGAAGTGGGCCCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 250
1169198748_1169198761 28 Left 1169198748 20:3697434-3697456 CCCCTGGGGTGCCCACAGGGTTG 0: 1
1: 0
2: 2
3: 35
4: 192
Right 1169198761 20:3697485-3697507 AGCCTAGGAGAAGTGGGCCCTGG 0: 1
1: 0
2: 4
3: 28
4: 266
1169198748_1169198758 13 Left 1169198748 20:3697434-3697456 CCCCTGGGGTGCCCACAGGGTTG 0: 1
1: 0
2: 2
3: 35
4: 192
Right 1169198758 20:3697470-3697492 GCTAGCTCACAGGGCAGCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 225
1169198748_1169198756 3 Left 1169198748 20:3697434-3697456 CCCCTGGGGTGCCCACAGGGTTG 0: 1
1: 0
2: 2
3: 35
4: 192
Right 1169198756 20:3697460-3697482 AGAAAAGCAAGCTAGCTCACAGG 0: 1
1: 0
2: 1
3: 18
4: 224
1169198748_1169198759 21 Left 1169198748 20:3697434-3697456 CCCCTGGGGTGCCCACAGGGTTG 0: 1
1: 0
2: 2
3: 35
4: 192
Right 1169198759 20:3697478-3697500 ACAGGGCAGCCTAGGAGAAGTGG 0: 1
1: 0
2: 5
3: 45
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169198748 Original CRISPR CAACCCTGTGGGCACCCCAG GGG (reversed) Intronic
900596239 1:3481428-3481450 CAACCCTGGGGACACTGCAGAGG - Intergenic
901932253 1:12603091-12603113 CTAGCTTGTGGGCACCCCAGAGG + Intronic
902561119 1:17278029-17278051 CCACCCTGTGGGCCTCACAGCGG - Intronic
904364730 1:30002963-30002985 AAAGCCTGTGGGCACCACAATGG - Intergenic
904386734 1:30147598-30147620 CAAGCCTGTGTGCATCCCACAGG - Intergenic
904460849 1:30678997-30679019 CAACCCTGTGGGCCACCTATTGG - Intergenic
906106571 1:43297447-43297469 ATCCCCTGTGGCCACCCCAGCGG - Intergenic
906143288 1:43546080-43546102 CAACCCTGGGGTCAGCCCACGGG + Intronic
906245058 1:44267628-44267650 CAAGCCTGAGGCCTCCCCAGTGG - Intronic
906514159 1:46429120-46429142 CACCCCTGGTGGCACCCCATGGG - Intergenic
911249807 1:95562395-95562417 CAATCCTGTGGGCAACCAAGAGG - Intergenic
911300345 1:96165178-96165200 CATACTTGTGGCCACCCCAGTGG - Intergenic
913609449 1:120495897-120495919 CAACCATCAGGGCAGCCCAGAGG + Intergenic
914581742 1:149025942-149025964 CAACCATCAGGGCAGCCCAGAGG - Intronic
915466094 1:156098928-156098950 ACAGCCTCTGGGCACCCCAGGGG - Intronic
919878602 1:201888358-201888380 CAGGCCTGTGGGCACCGCTGGGG + Intergenic
921273400 1:213492221-213492243 CACGCCTGTGGCCACCCGAGTGG - Intergenic
922771205 1:228184185-228184207 ACTCCCTGTGTGCACCCCAGGGG - Intergenic
923049319 1:230379674-230379696 CTAGCCTGTTGGCACCCCAGAGG + Intronic
923413366 1:233731452-233731474 CCACCCAGTGGGCAGGCCAGTGG + Intergenic
1062768681 10:83470-83492 TCTCCCTGTGGGCACCCCACTGG + Intergenic
1064104999 10:12493286-12493308 GAGCCCTGTGAGCACCCCAAAGG - Intronic
1066446780 10:35491128-35491150 CCAACCTGTGGCCACCCCAGTGG + Intronic
1067274558 10:44822106-44822128 CAGCCCTGGGGGCAGCCCTGTGG - Intergenic
1069565262 10:69459807-69459829 CTCCTCTGTGGGTACCCCAGAGG + Intronic
1070369200 10:75765826-75765848 ACACACAGTGGGCACCCCAGCGG - Intronic
1071061383 10:81574256-81574278 CAACCATCTGGGCACCTCCGTGG - Intergenic
1073323908 10:102631638-102631660 GCACCCTGTGGGCACTCCTGTGG - Exonic
1076480204 10:130779912-130779934 CACCCCGGTGGTCACCCCTGTGG + Intergenic
1076795527 10:132796245-132796267 CAAACCTGTGGGCGCCCCGGAGG + Intergenic
1077239780 11:1504460-1504482 CAGCCATGTGGGCTGCCCAGTGG - Intergenic
1077444819 11:2586066-2586088 CCACCCTCTGGGCACCTCAGCGG - Intronic
1079131428 11:17749020-17749042 GAACCCTGTGAGCACCACGGAGG - Intronic
1085212230 11:74791525-74791547 CCAGACTTTGGGCACCCCAGAGG - Intronic
1085296724 11:75435551-75435573 CACCCCTGTGGGCCCCCGAGGGG - Exonic
1085418662 11:76337099-76337121 CATCCCCATGGGCACTCCAGAGG + Intergenic
1089631820 11:119788789-119788811 CATTTCTGTGGGCACCCCAGGGG - Intergenic
1090066977 11:123511404-123511426 AAACTCTGTGGGCACGCTAGAGG + Intergenic
1090976384 11:131683790-131683812 CAACCCAGAGTGCCCCCCAGGGG - Intronic
1091558845 12:1594947-1594969 TAACCCTGTGGGCGCCACGGGGG + Intronic
1098242060 12:68478096-68478118 CAACCATGTGGCCAGCCCATTGG - Intergenic
1098917711 12:76274471-76274493 CAGACCTGGGGTCACCCCAGAGG - Intergenic
1103237914 12:119389472-119389494 CAACCCTGCTGGCACCACAGGGG - Intronic
1104044701 12:125153573-125153595 CACCTCAGTGGGCACCACAGTGG + Intergenic
1104682429 12:130760947-130760969 CAAGCCTGTGGGGACCAGAGAGG - Intergenic
1104684335 12:130774861-130774883 GAACCATGAGGACACCCCAGGGG - Intergenic
1108027880 13:46197421-46197443 CAACCCTGTGTGCTCACCAATGG - Intronic
1112504762 13:99969174-99969196 CAGCGCTGTGGGATCCCCAGAGG + Intronic
1112813692 13:103248952-103248974 CCTGCCTGTGGGAACCCCAGAGG - Intergenic
1114666909 14:24383241-24383263 CAGCCCTGTGGAGAGCCCAGAGG - Intergenic
1120295395 14:82633877-82633899 CAACCCTGGGGGCGCTGCAGAGG - Intergenic
1121033485 14:90679482-90679504 CAACCCCCGGGGCAGCCCAGGGG - Intronic
1121720980 14:96108531-96108553 GAACACTGTGGGTACCACAGTGG - Intergenic
1121951559 14:98175262-98175284 CATCCCTGAGGGCTCTCCAGAGG - Intergenic
1122435024 14:101689365-101689387 CACCCCTGTGGGCTCCCCAGCGG + Intergenic
1122575231 14:102737750-102737772 CCACTCTGTGGGCACCCACGAGG - Intergenic
1123701058 15:22915089-22915111 CAACCCTGTGAGCCCTTCAGTGG + Intronic
1125478920 15:40066852-40066874 AACCCCTTTGGGCACCCCTGGGG - Intergenic
1125925166 15:43557195-43557217 CAGCACTGTGGGAACCCAAGGGG + Intronic
1126112076 15:45181202-45181224 CAACTCTGTGGGCAGCTCAATGG + Intronic
1127993436 15:64137299-64137321 CAAAGCTGTGGCCACCACAGGGG + Intronic
1129207601 15:74046246-74046268 CAACCTTGTGGTCACATCAGAGG + Exonic
1131564656 15:93475106-93475128 CATCCCAGTGGGCACACTAGGGG - Intergenic
1132148516 15:99443183-99443205 CAACCATGGGGGCACAGCAGTGG + Intergenic
1132379795 15:101358503-101358525 CTAGCCTGTGGGCTCCTCAGGGG + Intronic
1132584062 16:698471-698493 CACCCCTCTGGGCAGGCCAGGGG + Intronic
1132684938 16:1158355-1158377 CTACCCTGTCGTCACCCCCGGGG - Intronic
1138433142 16:56982206-56982228 CACCGCTGTGGGCATCCCTGAGG + Exonic
1138478067 16:57283816-57283838 CTACCCTGTGGGCGCCCGCGCGG - Intronic
1138629572 16:58282519-58282541 CAACTCCGTGGGCAGGCCAGCGG + Exonic
1139359783 16:66390431-66390453 CACCCGTGTGGGCACCTCTGTGG + Exonic
1139448505 16:67013444-67013466 CAAGCCTGGGAGAACCCCAGTGG + Intergenic
1139724643 16:68887283-68887305 CCACCCAGTGGCCACCCCAGAGG + Intronic
1141552806 16:84817463-84817485 CAACCCTGTAGGCTCCTCACCGG - Intergenic
1142280441 16:89145115-89145137 CTACCCTGTGGCAACCCCAACGG - Intronic
1142671072 17:1487599-1487621 TAAACCTGGGGGCACCGCAGCGG - Intronic
1142962129 17:3557613-3557635 CCACGCTCTGGGCTCCCCAGGGG + Intronic
1144521977 17:15958774-15958796 GAACCCTGTGTGCCCCCCAGAGG - Intronic
1145971652 17:28959803-28959825 CTACCCTGTGGGTACCACTGTGG - Exonic
1146285000 17:31568415-31568437 CACCCCGGTGGAGACCCCAGTGG - Intergenic
1146305301 17:31725724-31725746 GAACTCAGTGGGCAGCCCAGAGG + Intergenic
1146668201 17:34718715-34718737 CAATCCTGGGGGCTCCCCAGAGG - Intergenic
1147654108 17:42078758-42078780 CAACCCTGAGGCCACCCCCAGGG - Intergenic
1148541209 17:48482151-48482173 CAACCCTGTGAGCATTACAGTGG + Intergenic
1148661656 17:49338795-49338817 CAAGCCTTAGGGCACCCCAAGGG + Intronic
1148695877 17:49557713-49557735 CCACCCAGTGGACACCCGAGGGG - Intergenic
1150782717 17:68135681-68135703 CAACCCTCTGCGCGCCTCAGCGG + Intergenic
1151329985 17:73401015-73401037 CTTACCTGGGGGCACCCCAGAGG + Exonic
1151694532 17:75707395-75707417 CAACCCCGGGGGGAGCCCAGTGG - Exonic
1151963379 17:77419133-77419155 AGACCCTGTGGGAACCCCCGAGG + Intronic
1152210247 17:78999285-78999307 CAGCCCTGTGACCACCTCAGGGG - Intronic
1152371657 17:79892105-79892127 CACCCCTGTGGGCCCTCCACGGG - Intergenic
1152707577 17:81852697-81852719 CATCCATGTGGGCTCCCCACAGG - Intronic
1152961562 18:83301-83323 TCTCCCTGTGGGCACCCCACTGG + Intergenic
1155533909 18:26795578-26795600 CAACCCTGTGGCCACCACCATGG - Intergenic
1155767513 18:29653407-29653429 CACCCCTGTGGCCACCCCACTGG - Intergenic
1156204833 18:34873964-34873986 CAGCCCATTGGGCACCCCATGGG + Intronic
1159035760 18:63275793-63275815 CCACCACGTGGGCACCCCAGTGG - Intronic
1159881676 18:73864305-73864327 GAAGCATGTGGGCATCCCAGAGG + Intergenic
1161212355 19:3074022-3074044 CAACACTTTGGGCAGCCAAGGGG - Intergenic
1162096071 19:8310667-8310689 CAACTCTGTTGGCACTCCAGGGG - Intronic
1162405216 19:10469021-10469043 CATCCCTCTGTCCACCCCAGGGG + Exonic
1162449913 19:10748428-10748450 CATCCCTGTGGTCACCCCAAAGG - Intronic
1163694468 19:18757011-18757033 CCACCCCTCGGGCACCCCAGTGG + Intronic
1164596439 19:29533466-29533488 CCACCTTCTGGGCACCCCAAAGG - Intronic
1164720494 19:30428527-30428549 CCACCCTGTGGGGACCACAGTGG + Intronic
1164983316 19:32630329-32630351 CTGCCCTGCGGGCACCTCAGCGG + Intronic
1166236794 19:41462692-41462714 CAAGCCTGAGGGCACTGCAGGGG + Intergenic
1167064754 19:47176549-47176571 GGACCCTGTGGGGACTCCAGTGG - Intronic
1167425400 19:49427533-49427555 CCACTCTGCGGGCACCCCAGAGG + Exonic
1167466789 19:49654425-49654447 CAACCAGGTGGGCTCCCCTGGGG + Exonic
1168153373 19:54460665-54460687 AAATCCTGTGGGCACCCGAATGG + Intronic
925184868 2:1840268-1840290 CACCCCCTTGGGCAGCCCAGCGG + Intronic
926319148 2:11736321-11736343 CAACCCTGCCGGCACCCCAGTGG - Intronic
931557155 2:63518537-63518559 AAACCCTCTGGGCTCCCCACTGG - Intronic
931590785 2:63880877-63880899 CAGGCCTGTGGGCACTCCAGGGG - Intronic
936648999 2:114404767-114404789 CAACCCTGTTGGAGCTCCAGAGG - Intergenic
938054449 2:128203550-128203572 CCACCCAGTGCCCACCCCAGAGG + Intergenic
938149664 2:128871274-128871296 AAATCTTGTGGGCACCACAGTGG + Intergenic
940536480 2:154951658-154951680 GGACCTTGTGGGCACCCGAGAGG + Intergenic
946417967 2:219550076-219550098 CAACCCTGAGCACACCCCAATGG - Exonic
947588293 2:231370428-231370450 CAACTCTGTGAGCTCCACAGAGG - Intronic
948424594 2:237878946-237878968 CAACCCTCTGGGGTCTCCAGGGG + Intronic
948455775 2:238104005-238104027 CAACTCAGTGTCCACCCCAGAGG - Intronic
949027905 2:241774899-241774921 CAGCCCCGTCCGCACCCCAGGGG + Intergenic
949072490 2:242033995-242034017 CCACCTTGGGGGCACCACAGAGG + Intergenic
1168880827 20:1204734-1204756 CAACCCTGTCATCACCCCAGAGG + Intronic
1169198748 20:3697434-3697456 CAACCCTGTGGGCACCCCAGGGG - Intronic
1171439009 20:25146709-25146731 CAACCCTGGAGGGACCCCAGGGG + Intergenic
1172667954 20:36613789-36613811 CAGCCTCCTGGGCACCCCAGAGG - Exonic
1174428444 20:50449934-50449956 CAGCCCTGTGAGCCCCTCAGTGG + Intergenic
1176216592 20:63950998-63951020 CACTCCTGTGGGCAGCACAGTGG + Intronic
1176412875 21:6458286-6458308 CAACTCTGTGGGAACCAGAGAGG + Intergenic
1179540953 21:42083000-42083022 CAACCCGGTGGGGTCCCCATGGG - Intronic
1179688368 21:43066608-43066630 CAACTCTGTGGGAACCAGAGAGG + Intronic
1180077967 21:45472765-45472787 GAAACCTGTGGGAAACCCAGGGG + Intronic
1180163156 21:46006965-46006987 GAACCCAGTGTGCAGCCCAGGGG - Intergenic
1181032872 22:20156743-20156765 CAAGCCGGTGGGCTCCTCAGGGG - Intergenic
1181931852 22:26408265-26408287 CATCCCTCTGGGGACCCCAGGGG + Intergenic
1183187906 22:36302917-36302939 CACCCCCATGGGCACCTCAGTGG - Intronic
1183484488 22:38081884-38081906 CTCACCTGTGAGCACCCCAGCGG + Exonic
1183705774 22:39474178-39474200 AAACCATGTGAGCACCCCGGTGG - Intronic
1184730178 22:46367405-46367427 CGACACAGTGGGGACCCCAGAGG - Intronic
1184736186 22:46399004-46399026 TAACACTGTGGGAACCCAAGAGG + Intronic
950092253 3:10304306-10304328 CAAAGCTGTGGACGCCCCAGAGG - Intronic
950640158 3:14343542-14343564 GATCCCGGTGGGCTCCCCAGGGG - Intergenic
951772416 3:26273331-26273353 CAACCCTGAGGGAAATCCAGGGG - Intergenic
953620136 3:44525911-44525933 CAACCCTGGGAGCACCCCGGTGG - Intergenic
954636084 3:52071598-52071620 CAAGCCTGTGCTCTCCCCAGAGG + Intergenic
956659520 3:71583907-71583929 CACCCCGCTGGGCACTCCAGCGG + Intronic
961171889 3:124802972-124802994 CAGCCCTGTGGGAACAGCAGGGG - Intronic
962200833 3:133400050-133400072 AAACCCACTGGGCACCACAGAGG + Exonic
964302595 3:155305713-155305735 CAACACTTTGGGAACCCTAGGGG + Intergenic
968454469 4:689902-689924 CCACCCTGGGGGAACCCAAGAGG + Intergenic
968483100 4:845562-845584 CAACTCTGTGGGCCTCCAAGTGG - Intergenic
968595614 4:1480907-1480929 CCACCCTGTGGCCAGCCCTGGGG - Intergenic
969389081 4:6877304-6877326 CAAGCCTGTGGGCACCACGAAGG + Intronic
970067828 4:12119530-12119552 CTACCCTGGGGGCATCCCAAGGG - Intergenic
979364260 4:119801869-119801891 CAACACTGTGGGAGGCCCAGGGG - Intergenic
980974288 4:139596296-139596318 CAGCCCTGTGGGCACCCAGGTGG + Intronic
983254197 4:165379549-165379571 CAGCCCTGGGGGCATCCCGGAGG + Intronic
983690773 4:170465887-170465909 CAACCCTGTGTGGAACCCAGGGG - Intergenic
984292005 4:177807813-177807835 CACCCCTGTTGGCACCTAAGTGG - Intronic
985753059 5:1693862-1693884 CAATCCTGTGGTCCCCCCAGGGG + Intergenic
986312305 5:6560803-6560825 CAACCCTGTGGACATACCAATGG + Intergenic
986741471 5:10709519-10709541 CAACCCTCTGGGCAGTGCAGTGG - Intronic
989108666 5:37886768-37886790 CAACCCTGGGGGCACTTCACAGG + Intergenic
989559719 5:42836653-42836675 CAGCCCTGTGGGCTCCCATGCGG + Intronic
992890663 5:81201108-81201130 CTCCCCTGGGGGCTCCCCAGGGG - Intronic
995133929 5:108660223-108660245 CTCGCCTGTGGGAACCCCAGGGG + Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002369786 5:178742506-178742528 CAAGTCTGTGCACACCCCAGAGG + Intergenic
1002593418 5:180306496-180306518 CCACCCTCTGGGCAGCCCTGTGG + Intronic
1002712008 5:181200964-181200986 CAACCCTGACGGCAGCCCAGTGG + Intronic
1003550520 6:7098620-7098642 CAATGCTATGGGCACCCCAGAGG - Intergenic
1003640094 6:7869074-7869096 CAAGCCTGTGGGCTCCCAGGGGG - Intronic
1005926162 6:30447507-30447529 AAGCCCAGAGGGCACCCCAGAGG + Intergenic
1006415939 6:33903991-33904013 CAGCCCTGAGGGCATCCCAAAGG - Intergenic
1006446442 6:34082338-34082360 CTACTCTGTGGGCTCCCCACTGG + Intronic
1006767006 6:36515247-36515269 CACCCCTGTGGTCATCCCAGTGG - Intronic
1007625816 6:43245883-43245905 CAACCTTGTGGCCACTCCAGAGG - Intronic
1014934029 6:127365515-127365537 AAAACCTTGGGGCACCCCAGGGG + Intergenic
1016401720 6:143688479-143688501 AAAACTTGTGGGCATCCCAGAGG + Intronic
1017893448 6:158658466-158658488 CAAGCCAGTGGGGACACCAGTGG + Intronic
1018947261 6:168356592-168356614 CAAGCGTGTGAGCACCGCAGCGG + Intergenic
1019328340 7:450698-450720 CCACCCTGTGGGCTCCACACAGG - Intergenic
1019480503 7:1264586-1264608 CCACCCTGTGTGCACCCTGGAGG + Intergenic
1019482829 7:1274314-1274336 CAGGCCTGCGGGCACCCCAGGGG - Intergenic
1022503281 7:30895778-30895800 CCACACTGTGGTCACCCCAGAGG - Intergenic
1023023779 7:36033618-36033640 CAATACTGTGGGCTCCCTAGAGG - Intergenic
1023847508 7:44130883-44130905 CAGCCCTGTGTGCACACCACTGG - Intergenic
1024063206 7:45714011-45714033 CCACCCCATGTGCACCCCAGAGG - Exonic
1025014793 7:55430454-55430476 CATCCCTGTGGTCCCCCCAGAGG - Intronic
1026730706 7:72909618-72909640 CACACCTGTGTGCAACCCAGAGG + Intronic
1028155208 7:87421594-87421616 TAACCCAGTGGGCACCACATAGG - Intronic
1028388723 7:90290579-90290601 CAAATCTCTGGCCACCCCAGGGG + Intronic
1035019703 7:155793767-155793789 CATCCCCTTGGACACCCCAGTGG + Intergenic
1038191225 8:25323016-25323038 CACCACTGTGGGGACCCAAGGGG + Intronic
1039424440 8:37474345-37474367 CATCCCTGTGTGCTCCCCACAGG - Intergenic
1040296637 8:46152307-46152329 CCACCCGGGGGTCACCCCAGGGG + Intergenic
1040318419 8:46276966-46276988 CAACCCTGTGGGCTCCTCTGGGG + Intergenic
1040320267 8:46290855-46290877 CAATCTTGTTGGCTCCCCAGAGG + Intergenic
1041166943 8:55101234-55101256 CAGCCCAGTGGGCACCGCACCGG - Intergenic
1042859078 8:73295139-73295161 CAACCCGGCGGGCACCTCGGGGG + Exonic
1045026958 8:98096809-98096831 CTACCCTGTGGGTGCCTCAGGGG - Intergenic
1045705535 8:104918212-104918234 CAATCCTGTGAGCAACCCAATGG - Intronic
1049454891 8:142681796-142681818 CAATCCTGAGGCCAGCCCAGGGG + Intronic
1049689686 8:143953114-143953136 CCACCCTGTGGGAACCGAAGCGG + Intronic
1051629589 9:19128995-19129017 CAACGCTGTGGGCCTCTCAGGGG - Intronic
1051947032 9:22581446-22581468 CCAGCCTGTGCGAACCCCAGGGG - Intergenic
1055381310 9:75709929-75709951 CAGCCCTGTGCGCATTCCAGGGG + Intergenic
1057190561 9:93084692-93084714 CATTCCTGTGGCCAGCCCAGAGG - Exonic
1057797687 9:98170276-98170298 CAGCCCTGTGGGTACCCAGGGGG + Intronic
1060300088 9:122369963-122369985 CCATCCTGTGGGCCCCACAGTGG - Intergenic
1061288543 9:129637990-129638012 CCACCCTGTGGGCAGCCTGGCGG - Exonic
1061424403 9:130490034-130490056 AGGCCCTGTGGCCACCCCAGTGG - Intronic
1062117621 9:134817872-134817894 CCACCCTCTGGGCTCCCCTGGGG - Intronic
1062360694 9:136186578-136186600 CAGCCCTCTGGGCAACCCAAGGG + Intergenic
1062365442 9:136206000-136206022 CCAGCCTGAGGGCACCTCAGAGG - Intergenic
1062488481 9:136792637-136792659 CAGCCACGTGGGCACCCGAGAGG + Intronic
1062736589 9:138140817-138140839 TCTCCCTGTGGGCACCCCACTGG - Intergenic
1203774175 EBV:63504-63526 CACCCCTGTGGGCCCCCTGGTGG + Intergenic
1186459886 X:9739804-9739826 CAGCCCTGTGGGCATCCTGGGGG - Intronic
1189259495 X:39668393-39668415 CAACCCTGTGGGCTGCCTATGGG + Intergenic
1190879095 X:54479978-54480000 GAACCCTGTGGGTAGCTCAGGGG + Intronic
1192451291 X:71246615-71246637 CAACACAGTGAGGACCCCAGAGG - Exonic
1198281620 X:135148336-135148358 CAACCTTATGCGCATCCCAGGGG + Intergenic
1198289339 X:135224186-135224208 CAACCTTATGCGCATCCCAGGGG - Intergenic
1199676212 X:150191275-150191297 GCACCCTGTGGGCAGCTCAGGGG - Intergenic
1201189615 Y:11435891-11435913 CACCCCTGTGGACACCACGGGGG + Intergenic