ID: 1169204380

View in Genome Browser
Species Human (GRCh38)
Location 20:3732039-3732061
Sequence CTGAGGCCCCATGCCCGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169204380_1169204386 30 Left 1169204380 20:3732039-3732061 CCTTGCCGGGCATGGGGCCTCAG No data
Right 1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169204380 Original CRISPR CTGAGGCCCCATGCCCGGCA AGG (reversed) Intergenic
No off target data available for this crispr