ID: 1169204382

View in Genome Browser
Species Human (GRCh38)
Location 20:3732056-3732078
Sequence GCGCGGAGTCTCACAGACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169204382_1169204388 24 Left 1169204382 20:3732056-3732078 CCTCAGTCTGTGAGACTCCGCGC No data
Right 1169204388 20:3732103-3732125 GACAGAGCTAGGCCTAGCCTGGG No data
1169204382_1169204387 23 Left 1169204382 20:3732056-3732078 CCTCAGTCTGTGAGACTCCGCGC No data
Right 1169204387 20:3732102-3732124 AGACAGAGCTAGGCCTAGCCTGG No data
1169204382_1169204386 13 Left 1169204382 20:3732056-3732078 CCTCAGTCTGTGAGACTCCGCGC No data
Right 1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG No data
1169204382_1169204389 25 Left 1169204382 20:3732056-3732078 CCTCAGTCTGTGAGACTCCGCGC No data
Right 1169204389 20:3732104-3732126 ACAGAGCTAGGCCTAGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169204382 Original CRISPR GCGCGGAGTCTCACAGACTG AGG (reversed) Intergenic
No off target data available for this crispr