ID: 1169204384

View in Genome Browser
Species Human (GRCh38)
Location 20:3732078-3732100
Sequence TGCTCAAGTTCAGACGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169204384_1169204386 -9 Left 1169204384 20:3732078-3732100 CCTCCGTCGTCTGAACTTGAGCA No data
Right 1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG No data
1169204384_1169204387 1 Left 1169204384 20:3732078-3732100 CCTCCGTCGTCTGAACTTGAGCA No data
Right 1169204387 20:3732102-3732124 AGACAGAGCTAGGCCTAGCCTGG No data
1169204384_1169204391 12 Left 1169204384 20:3732078-3732100 CCTCCGTCGTCTGAACTTGAGCA No data
Right 1169204391 20:3732113-3732135 GGCCTAGCCTGGGGACCCGAGGG No data
1169204384_1169204388 2 Left 1169204384 20:3732078-3732100 CCTCCGTCGTCTGAACTTGAGCA No data
Right 1169204388 20:3732103-3732125 GACAGAGCTAGGCCTAGCCTGGG No data
1169204384_1169204389 3 Left 1169204384 20:3732078-3732100 CCTCCGTCGTCTGAACTTGAGCA No data
Right 1169204389 20:3732104-3732126 ACAGAGCTAGGCCTAGCCTGGGG No data
1169204384_1169204390 11 Left 1169204384 20:3732078-3732100 CCTCCGTCGTCTGAACTTGAGCA No data
Right 1169204390 20:3732112-3732134 AGGCCTAGCCTGGGGACCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169204384 Original CRISPR TGCTCAAGTTCAGACGACGG AGG (reversed) Intergenic
No off target data available for this crispr