ID: 1169204386

View in Genome Browser
Species Human (GRCh38)
Location 20:3732092-3732114
Sequence ACTTGAGCAAAGACAGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169204384_1169204386 -9 Left 1169204384 20:3732078-3732100 CCTCCGTCGTCTGAACTTGAGCA No data
Right 1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG No data
1169204381_1169204386 25 Left 1169204381 20:3732044-3732066 CCGGGCATGGGGCCTCAGTCTGT No data
Right 1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG No data
1169204382_1169204386 13 Left 1169204382 20:3732056-3732078 CCTCAGTCTGTGAGACTCCGCGC No data
Right 1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG No data
1169204383_1169204386 -4 Left 1169204383 20:3732073-3732095 CCGCGCCTCCGTCGTCTGAACTT No data
Right 1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG No data
1169204380_1169204386 30 Left 1169204380 20:3732039-3732061 CCTTGCCGGGCATGGGGCCTCAG No data
Right 1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169204386 Original CRISPR ACTTGAGCAAAGACAGAGCT AGG Intergenic
No off target data available for this crispr