ID: 1169204754

View in Genome Browser
Species Human (GRCh38)
Location 20:3733264-3733286
Sequence TCAAGCTGGCCCGGAAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 178}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169204754_1169204764 -5 Left 1169204754 20:3733264-3733286 CCTGGTCTTCCGGGCCAGCTTGA 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1169204764 20:3733282-3733304 CTTGAGGTCCAGGTGGGGTGGGG 0: 1
1: 0
2: 3
3: 42
4: 391
1169204754_1169204768 13 Left 1169204754 20:3733264-3733286 CCTGGTCTTCCGGGCCAGCTTGA 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1169204768 20:3733300-3733322 TGGGGTCCAGGTTCCCGCTAGGG No data
1169204754_1169204770 19 Left 1169204754 20:3733264-3733286 CCTGGTCTTCCGGGCCAGCTTGA 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1169204770 20:3733306-3733328 CCAGGTTCCCGCTAGGGCAGTGG 0: 1
1: 0
2: 3
3: 12
4: 144
1169204754_1169204765 1 Left 1169204754 20:3733264-3733286 CCTGGTCTTCCGGGCCAGCTTGA 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1169204765 20:3733288-3733310 GTCCAGGTGGGGTGGGGTCCAGG 0: 1
1: 1
2: 6
3: 51
4: 459
1169204754_1169204762 -7 Left 1169204754 20:3733264-3733286 CCTGGTCTTCCGGGCCAGCTTGA 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1169204762 20:3733280-3733302 AGCTTGAGGTCCAGGTGGGGTGG No data
1169204754_1169204760 -10 Left 1169204754 20:3733264-3733286 CCTGGTCTTCCGGGCCAGCTTGA 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1169204760 20:3733277-3733299 GCCAGCTTGAGGTCCAGGTGGGG 0: 1
1: 0
2: 1
3: 25
4: 274
1169204754_1169204767 12 Left 1169204754 20:3733264-3733286 CCTGGTCTTCCGGGCCAGCTTGA 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1169204767 20:3733299-3733321 GTGGGGTCCAGGTTCCCGCTAGG 0: 1
1: 0
2: 0
3: 11
4: 128
1169204754_1169204763 -6 Left 1169204754 20:3733264-3733286 CCTGGTCTTCCGGGCCAGCTTGA 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1169204763 20:3733281-3733303 GCTTGAGGTCCAGGTGGGGTGGG 0: 1
1: 0
2: 1
3: 28
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169204754 Original CRISPR TCAAGCTGGCCCGGAAGACC AGG (reversed) Intronic
901473822 1:9475484-9475506 TCCAGCGGGCCGGGAAGACTTGG - Intergenic
903813396 1:26046952-26046974 CCAAGCTGGCCAGGAAGGACAGG - Intergenic
905616279 1:39402360-39402382 TCAACCTGGCCTGGAAGCTCAGG - Intronic
907721226 1:56974243-56974265 TCAGGCTGGCCCGGAAGGAAGGG + Intergenic
908493151 1:64666665-64666687 TCAGGCTGGTCCGGAACTCCTGG - Intronic
910307785 1:85786370-85786392 TCAGGCTTGCCAGGAAGCCCAGG - Exonic
910688264 1:89940212-89940234 CCAAGCTGGACTGGAACACCTGG - Intergenic
911729659 1:101279728-101279750 CCAAGCTGGTCTGGAAGTCCTGG - Intergenic
917801718 1:178577344-178577366 TCAAGCTGGCCTTGAATTCCTGG + Intergenic
918128421 1:181604359-181604381 TCAAGCTTGCCCAGAAGAAGAGG - Intronic
918603176 1:186388270-186388292 TCAAGCTGGCCTTGAACACCTGG - Intronic
918991461 1:191701947-191701969 TTAAGCTGGTCTGGAACACCTGG - Intergenic
920010249 1:202861770-202861792 TCGAGCTGGCCGGGAGGACGCGG - Intergenic
922204439 1:223434233-223434255 TCAAGCTGGCCTTGAACTCCTGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924026187 1:239835227-239835249 TCATGCTGGCACGGAGGATCCGG - Intronic
1064085665 10:12344722-12344744 TCCAGCTAGCCTGGAAGTCCAGG - Intergenic
1065863061 10:29887605-29887627 TCAAGCAGTCCCGCAAGAACTGG + Intergenic
1068740447 10:60463111-60463133 TCAAGCTGGTCTGGAAGTCCTGG + Intronic
1072009859 10:91293122-91293144 TCAAGCTGCCCAGGAAGCCAGGG - Intergenic
1072941318 10:99766700-99766722 TCAGGCTGGTCTGGAAGTCCTGG - Intergenic
1075088488 10:119429826-119429848 TGCTGCTGGCCCAGAAGACCCGG - Intronic
1076336429 10:129709831-129709853 TCAGGCAGGCCAGGAAGAACCGG + Intronic
1077367393 11:2166700-2166722 CCAGGCTGGCCAGGAAGTCCCGG + Exonic
1080617639 11:33958904-33958926 TCAAGCTGGCCTTGAACTCCTGG - Intergenic
1080780173 11:35421907-35421929 TTCAGCTGCCCTGGAAGACCAGG + Intergenic
1082825798 11:57577585-57577607 TCAAGCTGGCCTTGAACTCCTGG - Intergenic
1083773089 11:64879046-64879068 TCCAGCTGGCTCGGAATCCCCGG + Intronic
1084038291 11:66526742-66526764 TCAATGTGCCCCGAAAGACCCGG + Exonic
1085051478 11:73382321-73382343 TCACCCTGACCTGGAAGACCTGG - Intronic
1085280823 11:75329311-75329333 TCAGGCTGGCCTGGAACTCCTGG + Intronic
1086110716 11:83194943-83194965 TCAAGCTGGGCAAGAAGACTCGG - Intronic
1088894500 11:114067614-114067636 TCAGGCTGGCCTGGAACTCCTGG + Intronic
1092240899 12:6836014-6836036 TCAGGCTGGCCTGGAACTCCTGG - Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1097088044 12:56483653-56483675 TCAAGCTGGCCTTGAACTCCTGG + Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1101564979 12:105896565-105896587 TCAATTTGGCCCTGAACACCTGG + Intergenic
1102863852 12:116359044-116359066 TCTAGCTGGGCAGGAAGGCCAGG + Intergenic
1104458617 12:128935673-128935695 TCAGGCTGGTCTGGAAGTCCCGG + Intronic
1104694145 12:130851032-130851054 TCAGGCTGGCCTGGAACACCTGG - Intergenic
1106169361 13:27275671-27275693 TAAAGCTGGCCGTGAAGCCCTGG - Intergenic
1106269708 13:28140589-28140611 CCAAGCTGGCCTGGAACTCCTGG + Intronic
1106568870 13:30908911-30908933 CCAAGCTGGCCTCGAAGTCCTGG - Intronic
1108802141 13:54111733-54111755 TCAAGCTGGTCTGGAACTCCTGG - Intergenic
1110959884 13:81608292-81608314 TCAGGCTGGTCTGGAAGTCCTGG - Intergenic
1113098769 13:106694838-106694860 TCAATCAGGCCTGTAAGACCAGG + Intergenic
1113737911 13:112690773-112690795 TCGAGCTGTCCCGGCGGACCGGG + Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1117672261 14:58120616-58120638 CCAAGGTGGTCAGGAAGACCTGG + Intronic
1119310545 14:73642829-73642851 TCAAGCTGGTCTGGAACTCCCGG + Intergenic
1122873502 14:104652052-104652074 TCTAGCTGGGCCTGGAGACCCGG + Intergenic
1124786152 15:32682556-32682578 TCAAGCTGGCCTGGTAGAATTGG + Intronic
1124788975 15:32708675-32708697 TCAGGCTGGCACTGAACACCAGG + Intergenic
1126138048 15:45411525-45411547 TCAAGCTGGCCTTGAACTCCTGG + Intronic
1126403580 15:48300120-48300142 CCAAGCTGGCCCTGAACTCCTGG - Intronic
1129157731 15:73729154-73729176 TCAACCTGGTCCAGAAGCCCTGG + Intergenic
1131697640 15:94895931-94895953 TCAAGCAGGCAGTGAAGACCTGG - Intergenic
1133165996 16:3947655-3947677 TCAAGCTGGTCCTGAACTCCTGG + Intergenic
1134760859 16:16713722-16713744 CCAGGCTGGTCCGGAACACCTGG - Intergenic
1134985199 16:18645451-18645473 CCAGGCTGGTCCGGAACACCTGG + Intergenic
1135393113 16:22110546-22110568 TCTAGCTGGCCAGGAAGAAGAGG + Intronic
1136110581 16:28062149-28062171 TAGAGCTGGCCCGAAAGACGTGG - Intronic
1137276648 16:46938938-46938960 TGATGCTGGCCCGAAAGACTGGG - Intergenic
1138421595 16:56902711-56902733 TCAAGATGGGCAGGAGGACCAGG - Intronic
1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG + Intergenic
1144860729 17:18300002-18300024 CCAGGCTGGCCCAGAAGTCCTGG + Intronic
1145920581 17:28606316-28606338 TCAAGCTGTCCTGGAAGTCCTGG + Intronic
1148123776 17:45226510-45226532 GCAAGCTAGCAAGGAAGACCCGG - Intronic
1151208753 17:72528071-72528093 TCAAGCTGCCCAGTGAGACCTGG - Intergenic
1152760969 17:82106881-82106903 GTAAGCTGGCCTGGCAGACCTGG - Intronic
1152802323 17:82336766-82336788 TCAAGGAGGCCTGGAGGACCCGG - Intergenic
1157223193 18:45841491-45841513 ACAAGCTGGCCCAGGAGACTTGG + Intronic
1158388917 18:57027122-57027144 TCAAGCTGGCCCGGCTCATCTGG + Exonic
1158727062 18:59983294-59983316 CCAGGCAGGCCAGGAAGACCAGG + Intergenic
1161293966 19:3510342-3510364 TCAGGCTGGCCTTGAAGTCCTGG + Intronic
1161871840 19:6876403-6876425 TCAAGCTGGCCTTGAACTCCTGG + Intergenic
1162584781 19:11552087-11552109 TTGAGCTGGCCCGGAAGCCCTGG - Intronic
1166653885 19:44596007-44596029 TCAGGCTGGTCCGGAAGTCTTGG - Intergenic
1167394839 19:49221626-49221648 TCAAGCTGGTCTGGAACTCCTGG + Intergenic
924960436 2:29743-29765 TGAAGCTGGTTGGGAAGACCCGG + Intergenic
927275017 2:21255174-21255196 ACAAGCTGGCCAGGAAACCCTGG + Intergenic
928670841 2:33601907-33601929 TCAAGCTGGCCTTGAACCCCTGG - Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
931869863 2:66445913-66445935 TCCAGGCGGCCCGGAAGACTGGG - Intronic
932073381 2:68643153-68643175 TCAGGCTGGCCCAGGGGACCAGG + Intergenic
933970574 2:87466792-87466814 TCAAGCTGGCCCTGCTGAGCTGG + Intergenic
936115231 2:109696985-109697007 CCAGGCTGGTCCGGAAGTCCTGG + Intergenic
936323155 2:111483390-111483412 TCAAGCTGGCCCTGCTGAGCTGG - Intergenic
936894299 2:117409076-117409098 TTAAGCTGGCCCGGAAGCCTAGG - Intergenic
937213200 2:120291525-120291547 TCAAGCTGGTCCAGCAGACAAGG - Intronic
938728605 2:134128778-134128800 TCAAGCTGGTCTCGAAGTCCTGG + Intronic
939632158 2:144538185-144538207 CCAAGCTGGTCTCGAAGACCTGG + Intergenic
941078953 2:161037927-161037949 TCAAGCTGCCCCTGAAGACATGG - Intergenic
941686368 2:168452935-168452957 TCTGGCTGGCCCAGAAGGCCAGG + Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
942320371 2:174730811-174730833 TCATGCTGACCAGGAAGGCCCGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1169157877 20:3349143-3349165 CCAAGCTGGTCTGGAAGTCCTGG - Intronic
1169204754 20:3733264-3733286 TCAAGCTGGCCCGGAAGACCAGG - Intronic
1171133368 20:22675495-22675517 TGAAGCAGGCTCAGAAGACCGGG - Intergenic
1171860926 20:30402174-30402196 TCAGGCTGGCCTGGAACTCCTGG - Intergenic
1175001957 20:55639121-55639143 TCAAGGAGCCCCTGAAGACCAGG + Intergenic
1182264298 22:29101040-29101062 CCAAGCTGGCCTGGAACTCCTGG - Intronic
1182561747 22:31165125-31165147 TCAAGCTGGTCTGGAACTCCCGG + Intronic
1183654545 22:39177079-39177101 TCAAGCTGACCCGGGAATCCGGG + Intergenic
1185081256 22:48710562-48710584 CCATGCTGGCCAGGCAGACCTGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950140022 3:10609006-10609028 TCAAGGTGGCCCGGAATTCCGGG - Intronic
950178828 3:10896488-10896510 TCAAGGTGGCCCAGCAGAGCTGG + Intronic
950565750 3:13768611-13768633 TGAAGCCGGCCAGGAACACCAGG - Intergenic
951593078 3:24287569-24287591 TCAAGTTGACCAGGAAGAGCTGG - Intronic
952031550 3:29148638-29148660 TCAAGCTGGTCTGGAACTCCTGG + Intergenic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953163062 3:40440083-40440105 TCATGCTGGCCTTGAAAACCTGG + Intergenic
954710899 3:52504610-52504632 TCCAGGTGGCCCTGAAGACTGGG - Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
968476389 4:811353-811375 CCAAGCTGGCCTGGAACTCCTGG + Intronic
968776507 4:2544348-2544370 TCAAGCTGGTCCTGAACTCCTGG - Intronic
969027210 4:4183022-4183044 TCAAGCTTGCCCTGAAGTTCAGG + Intergenic
974208429 4:58738002-58738024 GCAACCTGGCCCAGAAAACCAGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
981196576 4:141928177-141928199 TCAGGCTGGCCTTGAACACCTGG - Intergenic
983484555 4:168318432-168318454 CCCTGCTGGCCCGGAAGGCCGGG - Intronic
984471134 4:180175820-180175842 TCAGGCTGGCCTGGAATGCCTGG - Intergenic
984730732 4:183065802-183065824 TCAAGCTGGTCTGGAACTCCTGG - Intergenic
984968455 4:185164310-185164332 TCAGGCTGGCCTGGAACTCCTGG + Intronic
985541336 5:488964-488986 GCAAGGGGGCCCGGAAGACGTGG + Intronic
985866868 5:2520688-2520710 TCAGGCTGCACAGGAAGACCGGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
988983218 5:36592468-36592490 TCAGGCTGGCCTGGAACTCCTGG - Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
998015953 5:138732301-138732323 TGAAGATGTCCCTGAAGACCAGG - Intronic
998262297 5:140640606-140640628 TCAGGCTGGTCTGGAACACCTGG + Intronic
999053810 5:148552125-148552147 TTAAGCTGGCACAGAAGACAAGG + Intronic
1001549265 5:172590860-172590882 TCAAGCTGGCCTTGAACTCCTGG - Intergenic
1003217239 6:4125520-4125542 TGAATCTGGTGCGGAAGACCAGG - Intronic
1007378461 6:41471690-41471712 TCAGGCTGGCCCAGAAGGCTTGG + Intergenic
1007734223 6:43970682-43970704 TGAAGCTGTCTTGGAAGACCAGG + Intergenic
1010585225 6:77650522-77650544 TCAAGCGGGCACGGGAGCCCTGG - Intergenic
1011632251 6:89339213-89339235 TCAAGCTGGCCTTGAACTCCTGG - Intronic
1013011095 6:106121067-106121089 CCAAGCTGGGCCTGAAGGCCAGG + Intergenic
1015665725 6:135626357-135626379 TCCAGCTGACCCAGAAGCCCAGG + Intergenic
1018186311 6:161267819-161267841 TCAAGCTGGCCTTGAATTCCTGG - Intronic
1018407191 6:163499458-163499480 TCAAGTTGGCAAGGAAGACTAGG + Intronic
1019171286 6:170134669-170134691 TCACGTGGGCCCGGAAGGCCGGG + Intergenic
1021203238 7:17750223-17750245 CCAGGCTGGCCTGGAACACCTGG + Intergenic
1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG + Intergenic
1023980103 7:45064533-45064555 TCAAGCTGGCCTGGAGGGACGGG + Exonic
1026218974 7:68374996-68375018 TCAGGCTGGTCTGGAAGTCCTGG - Intergenic
1026635627 7:72079392-72079414 GCAAGCAGGTCAGGAAGACCTGG - Intronic
1027495599 7:78884266-78884288 TCAAGCTGGTCTTGAAGTCCTGG - Intronic
1029290943 7:99501855-99501877 TCAGGCTGGCCTGGAACTCCTGG - Intronic
1031332588 7:120484362-120484384 TCAGGCTGGTCCTGAAGTCCTGG + Intronic
1032201203 7:129824510-129824532 TCAAGCTGGTCTGGAACTCCTGG + Intergenic
1032702895 7:134397726-134397748 TCAGGCTGGCCTGGATGCCCAGG + Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035725502 8:1823301-1823323 GGCAGCTGGCGCGGAAGACCCGG + Intergenic
1039413466 8:37374859-37374881 TCTAGTTGTCCTGGAAGACCAGG - Intergenic
1040111592 8:43569224-43569246 TCAACCTCCCCCGGAAGGCCTGG + Intergenic
1041009678 8:53529585-53529607 TTAAGCTGCCCCGGAGTACCAGG + Intergenic
1042755558 8:72206780-72206802 TCAGGCTGGTCTGGAAGTCCAGG - Intergenic
1043855058 8:85255471-85255493 TCAAGCTGGTCTGGAACTCCTGG + Intronic
1044827425 8:96211694-96211716 TCAAGCTGGCCTTGAACTCCTGG - Intergenic
1049193621 8:141303347-141303369 TCAGGCTGGCCTGGAACTCCTGG + Intronic
1049406025 8:142452210-142452232 GAAGGCTGGCCCGGGAGACCCGG + Intronic
1054911141 9:70456313-70456335 CCAAGCTGGCCTGGAAGTCCTGG - Intergenic
1060548476 9:124474457-124474479 TCAGGCTGGGCCTGGAGACCTGG + Intronic
1062364474 9:136202321-136202343 TCCAGCTGGCCCGGGAGTCGAGG + Intronic
1203429339 Un_GL000195v1:76003-76025 TCAGGCTGGTCCTGAACACCTGG - Intergenic
1187180822 X:16942128-16942150 TCAGGCTGGTCCGGAACTCCTGG + Intergenic
1187688683 X:21841588-21841610 TCAGGCTGGCCTGGAACTCCTGG - Intronic
1189459459 X:41226902-41226924 TCAAGCTGGCCTTGAACTCCTGG - Intronic
1189724522 X:43954914-43954936 GCAAACTGGCAGGGAAGACCTGG - Intronic
1190487640 X:50943707-50943729 TCAAGCTGGTCTGGAACCCCTGG + Intergenic
1192135533 X:68595709-68595731 TCAAGCTGGTCTGGAACTCCTGG + Intergenic
1192208414 X:69111083-69111105 TCAAGGTGGACCGGAAGAGAGGG - Intergenic
1197256170 X:124265686-124265708 TGAACCTGGCACTGAAGACCTGG + Intronic
1200120397 X:153787502-153787524 TCAAGCTGGCGCAGGAGAGCGGG - Exonic
1202242268 Y:22783554-22783576 CCAGGCTGGCCTGGAACACCTGG - Intergenic
1202272692 Y:23086092-23086114 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202293334 Y:23334590-23334612 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic
1202395252 Y:24417302-24417324 CCAGGCTGGCCTGGAACACCTGG - Intergenic
1202425689 Y:24719836-24719858 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202445100 Y:24950249-24950271 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic
1202475533 Y:25252792-25252814 CCAGGCTGGCCTGGAACACCTGG + Intergenic