ID: 1169206239

View in Genome Browser
Species Human (GRCh38)
Location 20:3741859-3741881
Sequence CTATGGCCACAAAGAGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169206235_1169206239 15 Left 1169206235 20:3741821-3741843 CCTCTCTGCCACAGAATCAGACA 0: 1
1: 0
2: 2
3: 11
4: 236
Right 1169206239 20:3741859-3741881 CTATGGCCACAAAGAGCAAGAGG 0: 1
1: 0
2: 1
3: 16
4: 207
1169206237_1169206239 7 Left 1169206237 20:3741829-3741851 CCACAGAATCAGACAGTCTGGTT 0: 1
1: 0
2: 2
3: 26
4: 221
Right 1169206239 20:3741859-3741881 CTATGGCCACAAAGAGCAAGAGG 0: 1
1: 0
2: 1
3: 16
4: 207
1169206234_1169206239 20 Left 1169206234 20:3741816-3741838 CCTCTCCTCTCTGCCACAGAATC 0: 1
1: 0
2: 3
3: 45
4: 423
Right 1169206239 20:3741859-3741881 CTATGGCCACAAAGAGCAAGAGG 0: 1
1: 0
2: 1
3: 16
4: 207
1169206233_1169206239 21 Left 1169206233 20:3741815-3741837 CCCTCTCCTCTCTGCCACAGAAT 0: 1
1: 1
2: 4
3: 41
4: 412
Right 1169206239 20:3741859-3741881 CTATGGCCACAAAGAGCAAGAGG 0: 1
1: 0
2: 1
3: 16
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169206239 Original CRISPR CTATGGCCACAAAGAGCAAG AGG Intronic
900483625 1:2911066-2911088 CACTGGCCACAGGGAGCAAGGGG - Intergenic
900583258 1:3419674-3419696 CTCTGGCCACACAGAGCTAGAGG + Intronic
900689673 1:3972981-3973003 CTAAGGTCACACAGAGTAAGTGG + Intergenic
901256219 1:7829473-7829495 TAATGGCCCCAAAGTGCAAGAGG - Intronic
902275575 1:15337120-15337142 CCATGGCCACCAGGAGGAAGGGG + Intronic
902665226 1:17932985-17933007 CTAAGGTCACAAAGGGCCAGTGG + Intergenic
904441412 1:30534376-30534398 CTACTGCCCCACAGAGCAAGGGG + Intergenic
907231543 1:53003982-53004004 TGATGGCCCCAAAGCGCAAGAGG - Intronic
910444804 1:87289241-87289263 CAGTGGCCACATAGAGCTAGTGG + Intergenic
910465444 1:87494211-87494233 TGAGGTCCACAAAGAGCAAGAGG + Intergenic
911873978 1:103135488-103135510 TGATGGCAATAAAGAGCAAGGGG - Intergenic
912464704 1:109863773-109863795 CTATTGCCACAAATAGCACTTGG - Intergenic
913390163 1:118301874-118301896 TCATAGCCACAATGAGCAAGTGG + Intergenic
918069262 1:181122996-181123018 CTAAGGACACAAAGTGTAAGGGG - Intergenic
918409450 1:184243688-184243710 CTCTGGCCACAAAGAGTGATTGG + Intergenic
918615104 1:186535111-186535133 CTATGGCCAAATACAGCAGGTGG - Intergenic
919405306 1:197173787-197173809 CCATGGGCACATAGAGAAAGAGG + Intronic
919832484 1:201551995-201552017 CCATGGCCAGCAAGAGGAAGTGG - Intergenic
920720430 1:208381761-208381783 CTAAGTCCACAAAGAGGAAGGGG + Intergenic
922423815 1:225476108-225476130 CCTTGGCCACCAAGAGGAAGGGG - Intergenic
923850048 1:237784591-237784613 CGCTGGCCACGAAGTGCAAGAGG - Exonic
923992776 1:239457161-239457183 CTATGGCCATACAAAGAAAGGGG - Intronic
1068662676 10:59638557-59638579 CAATGGACAGAAAGAGTAAGAGG - Intergenic
1068817701 10:61336213-61336235 TTATGGCCCCAAAGTGCAAAAGG + Intergenic
1069483092 10:68801752-68801774 TTATAGCCAGAAACAGCAAGTGG - Intergenic
1070929559 10:80251568-80251590 CCATGGGCACAAAGAGCTATGGG - Intergenic
1073289917 10:102408524-102408546 CTCTGGCCAGAAAGCGGAAGTGG + Intronic
1077395209 11:2317095-2317117 GGATGGCCAGGAAGAGCAAGTGG - Intronic
1078033115 11:7773609-7773631 CTATGTCCACAAAAGCCAAGTGG + Intergenic
1078640463 11:13090563-13090585 CTTAGGCCAGAAAGGGCAAGAGG - Intergenic
1079580217 11:22054922-22054944 CAATAGCCACATAGACCAAGTGG - Intergenic
1079590201 11:22174409-22174431 CTATGGCAACAAAGTAGAAGGGG + Intergenic
1080574216 11:33583565-33583587 CAATGGCCTCAAAAGGCAAGAGG - Intronic
1080701261 11:34646386-34646408 CTATGGCCAGGAACAGCCAGGGG + Intronic
1081290580 11:41320696-41320718 CCATGGAAAAAAAGAGCAAGGGG - Intronic
1081840798 11:46200171-46200193 CTAGAGCCTCAAACAGCAAGGGG + Intergenic
1083184408 11:61008808-61008830 CTGCGGCCACAAAGAGGACGCGG + Exonic
1083427143 11:62594039-62594061 CCCTGGCCAGAAAGAGCAAGTGG + Exonic
1084070640 11:66731706-66731728 CTGTGAACATAAAGAGCAAGGGG - Intergenic
1084312260 11:68324010-68324032 CTCTGGTTACAAAGAGCGAGTGG + Intronic
1085217338 11:74844167-74844189 CTATGTTCACAAAGAGAAACGGG - Exonic
1085417717 11:76330274-76330296 CTATGCCTGCAAAGACCAAGCGG - Intergenic
1094738285 12:33259887-33259909 CTAAGGCTGCATAGAGCAAGGGG - Intergenic
1099474493 12:83091998-83092020 ATATGTGCACAAAGAGGAAGGGG + Intronic
1108591024 13:51913021-51913043 CTTTGCCCAGAAAGAGGAAGTGG - Intergenic
1108597026 13:51958343-51958365 CAATGAACACAAAGAGCATGGGG + Exonic
1108742292 13:53350383-53350405 CTACGGGCACAAATAGCAAGAGG - Intergenic
1110420325 13:75300393-75300415 CTAGGGCCACAAAAATGAAGGGG + Intronic
1114942819 14:27636835-27636857 CCATGGCCAGAAACAGCTAGAGG - Intergenic
1115002547 14:28439954-28439976 TTATGGCCATAAATAGGAAGAGG - Intergenic
1118453362 14:65924179-65924201 TAATGGCCCCAAAGCGCAAGAGG + Intergenic
1118725127 14:68623557-68623579 CTGTATCCACAAAGAGGAAGGGG + Intronic
1125965698 15:43874070-43874092 CCATGGTCACAAGGAGCAAACGG + Exonic
1126398635 15:48246332-48246354 ATATGGCCACAAAGAACAGAGGG + Intronic
1127791507 15:62402653-62402675 TTATGGCCACAAACCTCAAGGGG + Intronic
1128700461 15:69800269-69800291 CAATTGCCACACACAGCAAGTGG + Intergenic
1128792389 15:70442790-70442812 CTAGGGGGACAAAGAGCCAGTGG - Intergenic
1129474643 15:75776390-75776412 CTATGGGACCTAAGAGCAAGAGG + Intergenic
1135261579 16:20985436-20985458 CTATGCCCACCAGGAGCAGGTGG + Exonic
1135935052 16:26772560-26772582 CTATGTCCAGAAAGAGGAATGGG - Intergenic
1136234041 16:28903677-28903699 CTATGGCCAGAGAGGACAAGAGG - Intronic
1137558331 16:49487381-49487403 CTATGGCGACCAATAGCAATAGG + Intergenic
1139299807 16:65935398-65935420 CTAGGGACACAAAGGCCAAGAGG + Intergenic
1139674995 16:68517568-68517590 CTTTGGTCACACTGAGCAAGTGG - Intergenic
1141894586 16:86950752-86950774 CTGTGGCCACTAAGATGAAGAGG - Intergenic
1143901382 17:10177175-10177197 CAAAGGCCACACAGAGGAAGGGG + Intronic
1144051856 17:11503563-11503585 CAATGACCACAAAGATAAAGAGG - Intronic
1145786210 17:27595562-27595584 CTGTGGCCAAAAAGAGCACTGGG - Intronic
1146003207 17:29143972-29143994 ATATGGCCACAAAGGGCATCTGG - Intronic
1148347325 17:46912180-46912202 GTATGGCCCCAAAGAGCAGCGGG + Intergenic
1149680593 17:58504407-58504429 CTGTGGCCACCAAGAGAATGTGG - Exonic
1149764853 17:59267109-59267131 GAATGGGCACAAAGGGCAAGAGG - Exonic
1152370622 17:79886472-79886494 CTAAGTCCACAAAGAGCTAAGGG - Intergenic
1152990087 18:355284-355306 CTATGGGAACAAACAGGAAGGGG + Intronic
1156627617 18:38928094-38928116 TAATGGCCACAAATAGCAAAAGG + Intergenic
1156707814 18:39904751-39904773 CTAAGGCCACAAATAGCTAGAGG + Intergenic
1162493663 19:11010629-11010651 CATTGCCCACAAAGAGCAAAAGG - Intronic
1164386869 19:27778902-27778924 CTATGGAAACAAACAGAAAGTGG - Intergenic
1164811019 19:31155834-31155856 TAATGGCCTCAGAGAGCAAGGGG + Intergenic
1164894647 19:31862140-31862162 CCTTGGCTGCAAAGAGCAAGAGG + Intergenic
927853393 2:26513622-26513644 CTTTAGCCACAATGAGCAAGAGG - Intronic
930876189 2:56219963-56219985 CTATGGGAACAAAGAGTAGGAGG + Intronic
933997622 2:87681319-87681341 CTATGGCAACCCAGGGCAAGGGG - Intergenic
934142608 2:89062483-89062505 CTACCTCCACAGAGAGCAAGCGG - Intergenic
934777391 2:96948214-96948236 CTATGACCACAGGGAGCGAGGGG - Intronic
935318869 2:101865608-101865630 CTATAGCCACATATAGCTAGTGG + Intronic
936296230 2:111269551-111269573 CTATGGCAACCCAGGGCAAGGGG + Intergenic
937583456 2:123517075-123517097 CTTTGGGCACAAGGAGAAAGGGG + Intergenic
938413241 2:131082913-131082935 ATATGTCCACTAAAAGCAAGGGG + Intronic
938734235 2:134171925-134171947 CTCTGGTCCCAAAGAGCAAGGGG + Intronic
940485986 2:154295904-154295926 GTAAGGCCACCAATAGCAAGTGG - Intronic
941551047 2:166915347-166915369 CTATGAACACAAAAAGCATGTGG + Intronic
945633658 2:212318913-212318935 CCATGGCTACAGAGAGCCAGTGG + Intronic
947623257 2:231604322-231604344 CTCTGGCAACAAGGAGCAGGTGG - Intergenic
947787753 2:232839162-232839184 TTCTGGCCAGGAAGAGCAAGGGG + Intronic
1169064769 20:2688803-2688825 CTGTGGCCACAGAGAGCTACAGG - Intergenic
1169206239 20:3741859-3741881 CTATGGCCACAAAGAGCAAGAGG + Intronic
1169395199 20:5222942-5222964 CCATAACCACAATGAGCAAGTGG - Intergenic
1170517895 20:17150711-17150733 CTATAGCGACAGAAAGCAAGTGG - Intergenic
1171232390 20:23497891-23497913 CAATGGTCACAAAGAGAGAGGGG + Intergenic
1173360505 20:42340104-42340126 CAATGGCCACAAGTAGCTAGTGG - Intronic
1173758240 20:45537358-45537380 TCCTGGCCACAATGAGCAAGTGG + Exonic
1175451650 20:59073770-59073792 CTATGGCCACTAAGAGGAATGGG + Intergenic
1177296623 21:19184114-19184136 ATATGGCTACAAAAAGAAAGAGG - Intergenic
1177509654 21:22068791-22068813 CTTTGACCAGAAAGACCAAGTGG - Intergenic
1179298124 21:40081473-40081495 CTATGGCCACAGAAGGCCAGTGG - Intronic
1179903340 21:44406388-44406410 CTAGCACCACAAAGTGCAAGAGG - Intronic
1180863834 22:19104468-19104490 ATTTGCCCACAAAGAACAAGAGG + Intronic
1181029964 22:20144926-20144948 CACTGGCCACAGAGAGCATGGGG - Intronic
1181167276 22:20990597-20990619 CCATGGCCACCAGGTGCAAGAGG - Intronic
1181513301 22:23398380-23398402 CACTGGCCACAGAGAGCATGGGG + Intergenic
1182006861 22:26967965-26967987 CTAAGGTCACACAGATCAAGAGG + Intergenic
1182566563 22:31204535-31204557 CCAGGGCCACAAATAGGAAGAGG - Exonic
1184912912 22:47548065-47548087 TTATGGCCACACTGGGCAAGTGG + Intergenic
1185340775 22:50290068-50290090 CTTTGCCCACAAACAGCACGCGG + Exonic
950816056 3:15703533-15703555 ATATGCCCTCAAAGAGGAAGTGG + Intronic
950823357 3:15787414-15787436 CACTGGCCACAAAGAGCTGGAGG + Intronic
951847411 3:27099318-27099340 AAATGGCCACTAAGAGTAAGAGG + Intergenic
954611606 3:51947324-51947346 CTGAGGTCACCAAGAGCAAGGGG + Intronic
955251097 3:57283232-57283254 CTTTGGGCAGCAAGAGCAAGAGG + Exonic
955950884 3:64240882-64240904 TTATGGCCAAGAAGAGGAAGGGG + Intronic
957627839 3:82677929-82677951 CTTTAGCCACAAAACGCAAGAGG + Intergenic
960838282 3:121929920-121929942 CTATGGCCACCAAGGTCAAGTGG + Intronic
963227255 3:142874858-142874880 CTATGGGAACACAGAGGAAGTGG + Intronic
964668534 3:159200363-159200385 CTGTGGCATCAAAGAGGAAGTGG + Intronic
964688197 3:159420820-159420842 CTATGGCCACAGTGGGCAATTGG + Intronic
965977918 3:174648065-174648087 CTATGGTCAAAAAGAAAAAGGGG + Intronic
966229721 3:177638887-177638909 AAATGGACACCAAGAGCAAGCGG - Intergenic
968947711 4:3674382-3674404 CTATGTCTACAAAGAGCCACGGG - Intergenic
970202100 4:13620458-13620480 CAATGTAAACAAAGAGCAAGTGG + Intronic
970330261 4:14975229-14975251 CTATGCCAGCAAAGACCAAGTGG - Intergenic
970609722 4:17713952-17713974 CTATGGAAACACAGAGGAAGCGG + Intronic
970663176 4:18308751-18308773 CTATGGTAACAAATATCAAGAGG + Intergenic
977454079 4:97235598-97235620 TTAAAGCCCCAAAGAGCAAGAGG - Intronic
977589623 4:98812454-98812476 CTATGGACACCAAAAGCATGTGG + Intergenic
977678724 4:99775261-99775283 CAATGGCCAAATAGACCAAGTGG + Intergenic
979399693 4:120233399-120233421 ATATGGCCAGCAAGAGAAAGAGG + Intergenic
979558598 4:122077863-122077885 CCAGGGCCACAAATAGGAAGAGG + Intergenic
980958572 4:139453271-139453293 CTCTGGCCACAAGGATCACGCGG + Intronic
981697357 4:147572668-147572690 CAATGGCCACAAGGGGCAAGAGG + Intergenic
983369471 4:166840447-166840469 CTTTGGCTACAAAGAGAAAAGGG + Intronic
983889453 4:173015930-173015952 CTGAGGCCACACAGAGCAGGGGG - Intronic
984704254 4:182836270-182836292 CTTTGGCCTCAAAGAGCTACAGG - Intergenic
985033141 4:185812262-185812284 CTATGGCTACGAAAAGCCAGTGG - Intronic
985149918 4:186936340-186936362 CTATTGCCTCAAATATCAAGGGG - Intergenic
985363317 4:189198877-189198899 CGATGGCCAGAAAGAGCAAGGGG - Intergenic
985664133 5:1173054-1173076 GTGAGGCCCCAAAGAGCAAGCGG + Intergenic
986561652 5:9066339-9066361 CTAAGGTCATAAACAGCAAGGGG - Intronic
987201108 5:15579252-15579274 CTATGGCCAAAAACAGCCTGGGG - Intronic
987300702 5:16595677-16595699 CTATTACTACTAAGAGCAAGAGG + Intronic
987742387 5:21927035-21927057 CTATGACCACAAACTCCAAGTGG - Intronic
988114331 5:26865458-26865480 CTCAGGGCACAAAGAGCATGGGG + Intergenic
991195904 5:63931976-63931998 GTATGGCCTCAAAGAGCAAATGG - Intergenic
992020783 5:72621603-72621625 CCATTGCCACAGAGAGCAAAAGG - Intergenic
992183689 5:74222849-74222871 CTGTGGCAGCAAAGAGGAAGTGG + Intergenic
992753670 5:79884569-79884591 CTATGCTGAGAAAGAGCAAGGGG + Intergenic
995028858 5:107456774-107456796 CTATGGCCATATTGAACAAGGGG - Intronic
995417164 5:111924566-111924588 CTATGGCCTCAATGAGGCAGAGG + Intronic
995655574 5:114422366-114422388 CTGTGTCCTCACAGAGCAAGGGG - Intronic
999101562 5:149029712-149029734 CTATTGCCACCAAGTGCAACCGG + Intronic
999367168 5:151030616-151030638 CTCTGGCCACACCGTGCAAGTGG + Exonic
999680483 5:154054734-154054756 CTAAGACCACAAAGGGCAGGAGG - Exonic
1000279992 5:159773890-159773912 CTAAGGCCAGAGAGAGAAAGGGG + Intergenic
1001169361 5:169404190-169404212 AGATGGCCTCAATGAGCAAGAGG + Intergenic
1001546669 5:172574679-172574701 CTCAGGCCACAAGGAGGAAGAGG - Intergenic
1001744836 5:174084433-174084455 CTCGGGCCTCAAGGAGCAAGCGG + Intronic
1002847777 6:963285-963307 CTATGGACACAGAGAGGAGGAGG + Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1004989801 6:21124656-21124678 CAATGGCCACAAAGAGAACGAGG + Intronic
1007246354 6:40466019-40466041 ATATGGCAAGAAAGAGAAAGTGG + Intronic
1008345080 6:50416747-50416769 TTATTGCCATAAAGAGCAAGGGG + Intergenic
1008503642 6:52208234-52208256 TTATGGACATAAAGAGCAAATGG + Intergenic
1010014600 6:71090065-71090087 CGATGGCCCCAAAGATCCAGAGG - Intergenic
1011258221 6:85445732-85445754 CTATGGCCACAAAGAGATCACGG + Intergenic
1011541847 6:88439164-88439186 TAATGGCCCCAAAGTGCAAGAGG + Intergenic
1014705837 6:124745932-124745954 CAAAGGCCAGAAAGAGCAATGGG + Intronic
1018462163 6:164008737-164008759 CTGAGGTCACAGAGAGCAAGTGG + Intergenic
1018476845 6:164151028-164151050 CTCTGCCCTCAAAGAGCAAAGGG - Intergenic
1023547916 7:41338677-41338699 CTATGGACACACAGAGGCAGTGG + Intergenic
1023999709 7:45182432-45182454 CTATAGCCACCAAGACCCAGAGG - Intronic
1026742063 7:72984973-72984995 CTCTGGACACACAGAGAAAGAGG - Intergenic
1026801908 7:73405401-73405423 CTCTGGACACACAGAGAAAGAGG - Intergenic
1027101672 7:75380104-75380126 CTCTGGACACACAGAGAAAGAGG + Intergenic
1027453048 7:78354676-78354698 TTATGACCACATAGAGCAGGAGG + Intronic
1028697377 7:93730826-93730848 CCATGTGCACAAAGAGAAAGGGG + Intronic
1028783467 7:94764700-94764722 CTAATGCCACAAGAAGCAAGAGG + Intergenic
1030679897 7:112423734-112423756 CCATGGCCACAAAGGGCCAGAGG - Intronic
1031146148 7:117999286-117999308 CTATGGCACCAAAGAGAATGTGG - Intergenic
1036164275 8:6417913-6417935 CTATTGTCGCAAAGAGCATGAGG + Intronic
1036287898 8:7460775-7460797 CTAAGGCCACAGAGAACAAATGG + Intronic
1036333578 8:7850753-7850775 CTAAGGCCACAGAGAACAAATGG - Intronic
1036615442 8:10384040-10384062 GTATGGCTTCACAGAGCAAGGGG - Intronic
1036684827 8:10902741-10902763 CTCTGACCACACAGAGCAATGGG + Intronic
1036709305 8:11068135-11068157 CTAGGGCCACAAAGAGCAGATGG - Intronic
1038020935 8:23551360-23551382 CCAAGGCCCCAAAGAGCAAGGGG - Intronic
1038552256 8:28480397-28480419 CTAAGGACACAAAGATGAAGAGG + Intronic
1041445602 8:57948343-57948365 CCATGGCCCCAAAGAGGCAGGGG + Intergenic
1041474182 8:58245228-58245250 ATAAGACCACAAAGAGCTAGAGG + Intergenic
1041943780 8:63419071-63419093 TTAGAGCCACAAAGAGCAATGGG + Intergenic
1042028397 8:64447920-64447942 CAATGGCCACCCAGAGAAAGTGG - Intergenic
1043360584 8:79467105-79467127 TTCTGGCTTCAAAGAGCAAGAGG + Intergenic
1044043605 8:87401372-87401394 ATATGGCCACAAAGGAAAAGGGG + Intronic
1044307098 8:90650391-90650413 CCATAGCCACACAGAGAAAGTGG + Intronic
1044328261 8:90885453-90885475 CTATGACCAAAAAGAGAATGAGG + Intronic
1047162549 8:122396901-122396923 TGATGGCTACACAGAGCAAGAGG + Intergenic
1048316883 8:133369441-133369463 CCATGGACACAGAGAGCAGGGGG - Intergenic
1053387617 9:37707151-37707173 CTATGGACACACAGAGAAGGGGG - Intronic
1053522312 9:38792524-38792546 CTCTGACCACATAGAGCAGGGGG - Intergenic
1054194539 9:62016944-62016966 CTCTGACCACATAGAGCAGGGGG - Intergenic
1054643869 9:67571746-67571768 CTCTGACCACATAGAGCAGGGGG + Intergenic
1055649542 9:78393866-78393888 CTAAGGCCACACAAGGCAAGGGG - Intergenic
1057302639 9:93895684-93895706 CTGAGGCCTCAAAGGGCAAGTGG - Intergenic
1186848233 X:13552865-13552887 CAATGGGCACCAAGGGCAAGTGG - Intergenic
1188174899 X:26977206-26977228 CCATCGCCAAAAAGAGAAAGAGG - Intergenic
1189563646 X:42216857-42216879 CAATGGCCACAAAATGCAGGTGG + Intergenic
1190167630 X:48086144-48086166 CTATCAGCACAAAGAGCCAGGGG - Intergenic
1191999349 X:67131878-67131900 CTCTGGGGACAAAGGGCAAGTGG - Intergenic
1192562317 X:72135260-72135282 CTAAGGCCAAAAAGACCAAAAGG + Intronic
1192785017 X:74326543-74326565 CTATGCACATAAAGACCAAGTGG - Intergenic
1195530872 X:105956124-105956146 CTATGGCGACAAAGGGGAAAAGG + Exonic
1196173954 X:112619619-112619641 CTAAGACCACAAAGGGCAAAGGG - Intergenic
1196543664 X:116937844-116937866 CTGAGGCTACACAGAGCAAGGGG + Intergenic
1197761603 X:130031984-130032006 CTCTGGCTACACAGAGGAAGAGG + Intronic
1199226365 X:145379550-145379572 CTATGGCTACAAAGAATAAAAGG + Intergenic
1200155624 X:153973363-153973385 CCAAGGTCACAAAGAGCAGGTGG - Intronic