ID: 1169208740

View in Genome Browser
Species Human (GRCh38)
Location 20:3754194-3754216
Sequence GGGCCGCATGGGTGGGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 409}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169208740_1169208766 24 Left 1169208740 20:3754194-3754216 CCCCGGCCCCACCCATGCGGCCC 0: 1
1: 0
2: 1
3: 38
4: 409
Right 1169208766 20:3754241-3754263 TCAGGGATCAGCTGGAGGTAGGG 0: 1
1: 0
2: 2
3: 20
4: 252
1169208740_1169208760 16 Left 1169208740 20:3754194-3754216 CCCCGGCCCCACCCATGCGGCCC 0: 1
1: 0
2: 1
3: 38
4: 409
Right 1169208760 20:3754233-3754255 CCCTTCCCTCAGGGATCAGCTGG 0: 1
1: 0
2: 4
3: 27
4: 228
1169208740_1169208762 19 Left 1169208740 20:3754194-3754216 CCCCGGCCCCACCCATGCGGCCC 0: 1
1: 0
2: 1
3: 38
4: 409
Right 1169208762 20:3754236-3754258 TTCCCTCAGGGATCAGCTGGAGG 0: 1
1: 0
2: 0
3: 24
4: 162
1169208740_1169208754 7 Left 1169208740 20:3754194-3754216 CCCCGGCCCCACCCATGCGGCCC 0: 1
1: 0
2: 1
3: 38
4: 409
Right 1169208754 20:3754224-3754246 GGACCCCTCCCCTTCCCTCAGGG 0: 1
1: 1
2: 4
3: 39
4: 456
1169208740_1169208765 23 Left 1169208740 20:3754194-3754216 CCCCGGCCCCACCCATGCGGCCC 0: 1
1: 0
2: 1
3: 38
4: 409
Right 1169208765 20:3754240-3754262 CTCAGGGATCAGCTGGAGGTAGG 0: 1
1: 0
2: 6
3: 24
4: 296
1169208740_1169208753 6 Left 1169208740 20:3754194-3754216 CCCCGGCCCCACCCATGCGGCCC 0: 1
1: 0
2: 1
3: 38
4: 409
Right 1169208753 20:3754223-3754245 GGGACCCCTCCCCTTCCCTCAGG 0: 1
1: 0
2: 11
3: 42
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169208740 Original CRISPR GGGCCGCATGGGTGGGGCCG GGG (reversed) Intronic
900013995 1:136712-136734 TGTCCGCGTGGGAGGGGCCGGGG + Intergenic
900137884 1:1126123-1126145 GGGCCGCGGGGTGGGGGCCGAGG + Intergenic
900284324 1:1891746-1891768 GGGCCGCCTGGCAGGGGCGGGGG + Intergenic
900432453 1:2609308-2609330 GGGCCGCCAGGAAGGGGCCGAGG - Intronic
900568182 1:3345691-3345713 GGGCAGCATGGGAGGACCCGAGG - Intronic
900638925 1:3678996-3679018 GGGCCGGACGGGTGGGATCGGGG + Intronic
900985827 1:6072410-6072432 GCGCCGCATGGATGGTGCCATGG + Intronic
901023791 1:6268658-6268680 GTGCCGCGTGCGTGGGGCCTGGG - Intronic
901689756 1:10965103-10965125 GGGCAGCCTGGGAGGGGCAGAGG - Intronic
901875909 1:12167078-12167100 GGGCGCCATGGGTGCGGGCGGGG - Exonic
901880622 1:12191715-12191737 GGGCAGCGTGGGTGTGGCGGAGG + Intronic
902182317 1:14698500-14698522 GGCCCACATGGGAGGGGCAGTGG - Intronic
902416553 1:16243117-16243139 GGACCGCATGGCTGGGGCCACGG - Intergenic
902556339 1:17249041-17249063 GGGCTGGAGGGGTGGGGCCAGGG + Intergenic
903295898 1:22342918-22342940 GGGCTGCATGGGTGGGAGAGAGG + Intergenic
903972781 1:27129936-27129958 AGGCAGCATGGTTGGGGCCATGG - Intronic
904454858 1:30641467-30641489 AGGCCTCATGGGTGGAGACGAGG - Intergenic
905896278 1:41547874-41547896 GGGCAGCCTGGGAGGGGCCTGGG - Intronic
906481673 1:46203420-46203442 GGCCCGCATGGAGGGGACCGTGG + Exonic
907243561 1:53093528-53093550 GGGCCGCATGGGTGACAGCGGGG - Exonic
910244495 1:85124009-85124031 GGGCCCCATGAATGGGGTCGGGG - Intronic
910450039 1:87335165-87335187 GGGGCGCTTGGGTGGAGCTGAGG - Intronic
911052419 1:93681883-93681905 GGCTCGCCGGGGTGGGGCCGCGG - Intronic
911712893 1:101095757-101095779 CAGCAGCATGGGTAGGGCCGTGG - Intergenic
912381320 1:109249658-109249680 GGGCCGCCGGGGCCGGGCCGGGG + Intergenic
912419913 1:109535918-109535940 GGGCAGCATGGGAAGGGCCCTGG + Intergenic
914386157 1:147172225-147172247 GAGGCGCAGGGGCGGGGCCGGGG - Intronic
914702948 1:150150386-150150408 GGGCCGCCGGGGCGGGGGCGCGG - Intronic
915568224 1:156728615-156728637 GGGCGGCGTGGGTGGGGGCGGGG + Exonic
916605990 1:166343081-166343103 GGGGCGCGTGGGGGGGGCGGGGG + Intergenic
916750840 1:167721839-167721861 GAGGCGCCTGGGTGGGACCGAGG + Intronic
917291616 1:173477260-173477282 GGGCGGCGGGGGCGGGGCCGCGG - Exonic
917793941 1:178519119-178519141 AGGCGGCCTGGGTGGGGCCCAGG + Intronic
922364844 1:224854170-224854192 AGCCCCCATGGGTGGGGCAGCGG - Intergenic
922753493 1:228082043-228082065 GGGCCGTGGGGGTGGGGCCCAGG - Intergenic
922917650 1:229271390-229271412 GGGGCGCGCGGGTCGGGCCGCGG + Intronic
923074469 1:230597426-230597448 GGGCAGCCTGTGTGGGGCTGGGG - Intergenic
923724438 1:236494273-236494295 GTGCCCCATGAGTGTGGCCGGGG - Intergenic
923744296 1:236686396-236686418 GGGCCCGACGGGCGGGGCCGGGG + Intergenic
1063300606 10:4845999-4846021 GGGCCACAGGGGGCGGGCCGGGG - Intronic
1066986899 10:42475971-42475993 GGGCCCCAGCGGTGGGGGCGGGG + Intergenic
1067344382 10:45427396-45427418 GGGAAGCAGGGGTGGGGACGGGG - Intronic
1067474291 10:46556133-46556155 GGGCAGCAAGGCTGGGGGCGGGG + Intergenic
1069626299 10:69869638-69869660 GGGCATGATGGGTGGGGCAGTGG - Intronic
1070810768 10:79296665-79296687 GGGCCCCGTGGGTGGTGGCGAGG - Intronic
1070935675 10:80293023-80293045 GGGCCGCAGGGGTGGTGGGGAGG + Intergenic
1075413771 10:122247948-122247970 GGGCCGGAGAGGTGGGGCAGAGG + Intronic
1075650968 10:124128232-124128254 GGGCCTCCTGGGTGAGGCCCAGG - Intergenic
1075711585 10:124533665-124533687 GGGCCACCTGGGTGAGGACGGGG - Intronic
1076035661 10:127196644-127196666 GGGCCGCGTGCGTGGGGTGGGGG + Intronic
1076253745 10:129003464-129003486 GGACAGCATGGGTGGGGCTCAGG - Intergenic
1076306202 10:129467189-129467211 GGGGCGCGGGGGCGGGGCCGAGG - Exonic
1076398744 10:130162798-130162820 AGGCCGCAGGGGTGGGCCTGAGG - Intronic
1076613750 10:131743112-131743134 GGAGGGCAAGGGTGGGGCCGTGG - Intergenic
1076629910 10:131846352-131846374 TGGCCACATGGGTGGGGCACGGG - Intergenic
1076717698 10:132374773-132374795 AGGACACCTGGGTGGGGCCGTGG + Intronic
1076797224 10:132804120-132804142 GGGCCGAGGGGATGGGGCCGAGG - Intergenic
1076854464 10:133109073-133109095 GAGGGGCAGGGGTGGGGCCGGGG - Intronic
1076970324 11:128877-128899 TGTCCGCGTGGGAGGGGCCGGGG + Intergenic
1077051361 11:568424-568446 GGGCCGGTCGGGTCGGGCCGGGG - Intergenic
1077052936 11:575912-575934 GGGCTGCGAGGGTGGGGGCGGGG + Intergenic
1077052990 11:576054-576076 GGGCTGCGGGGGTGGGGGCGGGG + Intergenic
1077360768 11:2139330-2139352 CGGCCGGAAGGGGGGGGCCGGGG + Intronic
1077557141 11:3231206-3231228 GGGCCTCATGGGTGGGCCCCAGG + Intronic
1077584028 11:3436747-3436769 GGGCAGCATTGGTTGGGCGGGGG + Intergenic
1079803183 11:24896471-24896493 GCGCAGCATGGGTGGGCCGGTGG - Intronic
1081650111 11:44818255-44818277 GGGCTGCATGGGCAGGGCCGTGG - Intronic
1082287820 11:50335736-50335758 TGGCTTCATGGGTCGGGCCGAGG - Intergenic
1082821341 11:57546362-57546384 GAGCTGCGTGGGTGGGGCAGGGG + Intronic
1083418294 11:62539432-62539454 GGGGCGGGAGGGTGGGGCCGAGG - Intronic
1083430665 11:62612442-62612464 GGGCCGGATGGACGGGGCCGCGG - Exonic
1083799531 11:65038582-65038604 CAGCCACATGGGTGGGGCTGGGG - Exonic
1084045995 11:66568131-66568153 GCGCCGCACGGGCGGGGCCTTGG - Intronic
1084240936 11:67819416-67819438 GGGCAGCATTGGTTGGGCGGGGG + Intergenic
1084409405 11:68997625-68997647 GGGCCGTATGGGTGGTGCAGCGG + Intergenic
1084756369 11:71241402-71241424 GGGTCGCCTGTGTGGGGCAGGGG - Intronic
1084831503 11:71773290-71773312 GGGCAGCATTGGTTGGGCGGGGG - Intergenic
1084891526 11:72239326-72239348 GGGCCCGAGGGGTGGGGCAGCGG + Exonic
1084962943 11:72726772-72726794 GGGCGGGATGGGTGGGGCAGCGG + Exonic
1084980200 11:72824857-72824879 GAGCCACATGGGTGGGGCAGTGG + Intronic
1085322945 11:75585699-75585721 GGGCGGCATGGGTGTGGCTGAGG - Intergenic
1085346924 11:75774211-75774233 GGGCCTCATGGGCAGGGCCCAGG + Intronic
1085741611 11:79082298-79082320 GGGGAGCTTGTGTGGGGCCGAGG - Intronic
1086840192 11:91675485-91675507 GGGACCCATGGTTGGGGCGGGGG + Intergenic
1087118002 11:94544548-94544570 GGGCGGCGCGGGTGGCGCCGAGG + Exonic
1087441173 11:98185398-98185420 GCACTGCATGGGTGGGCCCGTGG + Intergenic
1088613732 11:111602768-111602790 CGGCCGCAGTGGTGGGACCGGGG + Intronic
1088919838 11:114252789-114252811 GGGCAGGAGGGCTGGGGCCGAGG - Intergenic
1089249055 11:117144509-117144531 GGGCCGCAAGGGTGGGGGAGGGG - Intronic
1089289358 11:117428507-117428529 GCTCAGCAGGGGTGGGGCCGGGG + Exonic
1090074770 11:123573119-123573141 GGGCCCGATGGCTGGGGCAGGGG + Intronic
1091286486 11:134411407-134411429 GGGCAGCAGGGGTGGGGAGGTGG + Intronic
1094838723 12:34334217-34334239 GGGCAGCGTGGTTGGGGCCAGGG - Intergenic
1094839775 12:34338045-34338067 GGGGTGCATGGGTGGGGCCAGGG - Intergenic
1094841375 12:34343997-34344019 GAGCCGCAGGGGTGGGCCAGGGG - Intergenic
1094845169 12:34358350-34358372 GCCGCGCATGGGTGGGGCCCAGG - Intergenic
1095981199 12:47975702-47975724 CAGCCCCATGGGTGGGGCGGAGG + Intronic
1096519412 12:52175824-52175846 GGGCAGCAGAGGTGGGGCTGTGG - Intronic
1096573987 12:52541253-52541275 GGGCTGCATGGCTGGGGCCGGGG - Intergenic
1096627370 12:52903962-52903984 CGGCAGCGTGGGCGGGGCCGAGG - Intronic
1097057484 12:56258484-56258506 GGGCCGCCAGGGTGGGGCGGAGG - Intergenic
1097088690 12:56488252-56488274 GGGCCCGGTGGGTGGGGCTGGGG + Exonic
1097648074 12:62260319-62260341 CGGCCGACTGGGAGGGGCCGTGG + Intronic
1098924399 12:76333643-76333665 GGCCAGCATGGCTGGGGCAGGGG - Intergenic
1101249429 12:102917361-102917383 GGGCCGGAGGGGAGGGGCTGAGG + Exonic
1101493894 12:105235910-105235932 CGCCCGCAGGGGTGAGGCCGAGG - Intronic
1101844120 12:108348848-108348870 GGGCCCCAAGTGTGGGGCCATGG - Intergenic
1103561579 12:121795671-121795693 GGGAGGCAGGGCTGGGGCCGAGG + Intronic
1103702937 12:122856959-122856981 GGGCAGGGTGGGTGGGGCCTGGG + Intronic
1104974339 12:132545744-132545766 GGGCCACATGGGTGCACCCGTGG - Intronic
1105585485 13:21739104-21739126 GGGCGGCAAGGGTGGGGAGGCGG - Intergenic
1108408201 13:50125006-50125028 GGGCCGCCTTGCTGGGGTCGAGG - Intronic
1110899234 13:80799911-80799933 GGGCAGCATAGTTGGGGCGGTGG + Intergenic
1113853117 13:113429130-113429152 GGGCCGCTTGGGAGGGCCTGGGG + Intronic
1114259380 14:21025856-21025878 GGGGCGCGGGGGAGGGGCCGGGG + Intronic
1116018251 14:39432082-39432104 GGGCCGCCCGGGTGGCGCGGTGG - Exonic
1117978830 14:61322140-61322162 GGTCCGCATCGGTGAGGCAGTGG + Exonic
1118375790 14:65175859-65175881 GGACCCCATGGCTGGGGCCAAGG + Intergenic
1118451011 14:65902075-65902097 GAGCCGCAGGGGTGGGGTGGGGG + Intergenic
1119191973 14:72689091-72689113 GGGCAGCATGGGCGGGGGCGGGG + Intronic
1119623596 14:76151882-76151904 GGGCCGGAGGGGTGGGGCGGTGG - Intergenic
1121437123 14:93927421-93927443 GGGCCACGTTGGTGGGGCCTGGG + Intronic
1121467191 14:94123514-94123536 GGGCCTCATGGGTGGGACCCTGG + Intergenic
1122094470 14:99361210-99361232 GGGCCACAGGGGTGTGGCTGTGG + Intergenic
1122262644 14:100531926-100531948 GTGGGGCATCGGTGGGGCCGGGG - Intergenic
1122291188 14:100681277-100681299 AGGGGGCATGGGTGGGGCAGTGG + Intergenic
1122574591 14:102733574-102733596 GGGACGCATGACTGGGCCCGGGG - Intergenic
1122688770 14:103521984-103522006 GGGCCGGGCGGGCGGGGCCGGGG - Intronic
1122789094 14:104176870-104176892 CTTCCGCGTGGGTGGGGCCGGGG - Exonic
1122813703 14:104301823-104301845 AGGCCGCATGGGCGGGGAAGGGG + Intergenic
1123032384 14:105458136-105458158 GGGCCCCATAGGTGAGGCCAGGG - Intronic
1123115170 14:105891257-105891279 GGGCCTCCTGGGTGGGGGCAGGG + Intergenic
1123117354 14:105900704-105900726 GGGCCTCCTGGGTGGGGGCTGGG + Intergenic
1123118290 14:105904611-105904633 GGGCCCCATGGGGAGGGCTGTGG + Intergenic
1123119445 14:105909973-105909995 GGGCCTCCTGGGTGGGGGCTGGG + Intergenic
1123404363 15:20011219-20011241 GGGCCTCCTGGGTGGGGGCTGGG + Intergenic
1123513698 15:21017866-21017888 GGGCCTCCTGGGTGGGGGCTGGG + Intergenic
1123578969 15:21699043-21699065 GGCCCTAATGGGTGGGGCCACGG + Intergenic
1123615596 15:22141525-22141547 GGCCCTAATGGGTGGGGCCACGG + Intergenic
1123697185 15:22887315-22887337 GGGCCGCAGGGCTTGGGCCTGGG - Intronic
1123981338 15:25607386-25607408 GGGCAGCATGGGGTGGGCAGAGG - Intergenic
1124202855 15:27693214-27693236 GGGCCGCCTGGGGAGGGCTGCGG + Intergenic
1124629394 15:31328036-31328058 GGCGCGCTCGGGTGGGGCCGCGG + Intronic
1124966506 15:34436665-34436687 GGGCTCCATGGGTCGGGCGGCGG - Intronic
1124983114 15:34582756-34582778 GGGCTCCATGGGTCGGGCGGCGG - Intronic
1125091977 15:35803557-35803579 GGGCTGCAGGTGTGGGGCTGTGG - Intergenic
1126121089 15:45252182-45252204 GGGCAGCTTGGGTGGGGCATGGG - Intergenic
1128663862 15:69524134-69524156 GGCCTCCATGGGTGGGGCCCGGG + Intergenic
1128729829 15:70013670-70013692 GGGCTGCAGGGCTGGGACCGGGG + Intergenic
1128972266 15:72118084-72118106 GGGCCGCGTGCGCGGGGTCGGGG - Intronic
1129229906 15:74191327-74191349 GGGCAGCATGGCAGGGGCAGAGG - Intronic
1129234940 15:74218315-74218337 GGGAGCCATGGGTGGGGCCTAGG + Intergenic
1129298927 15:74614722-74614744 GAGGGGCATGGGCGGGGCCGCGG + Intronic
1129409085 15:75338958-75338980 GGGACCCGTGGGTGGGGCAGGGG - Intronic
1130656376 15:85794603-85794625 GGGCCCCGCGGCTGGGGCCGGGG - Intronic
1202987839 15_KI270727v1_random:433288-433310 GGCCCTAATGGGTGGGGCCACGG + Intergenic
1132613426 16:828845-828867 GGGCCGCTGGGGTGAGGACGGGG + Intergenic
1132646585 16:1002049-1002071 GAGCCCCAGGGGTGGGGGCGTGG + Intergenic
1132834050 16:1943487-1943509 GGGCGGCAGGGGCGGGGCCTTGG - Intergenic
1132854786 16:2039901-2039923 TGGCCGCATGGCTCTGGCCGAGG - Exonic
1132945117 16:2528161-2528183 GGGCCCCAGGGGCGGGGCTGGGG + Intronic
1133127448 16:3656003-3656025 GGGCCCCAAGGGTGGGGACCTGG + Intronic
1133352408 16:5110314-5110336 GGGCAGCATTGGTTGGGCGGGGG + Intergenic
1133771394 16:8868888-8868910 GAGCCGCAGGGGTGGGGCCTCGG - Intronic
1134834080 16:17346836-17346858 GTGCCAGATGGGTGGGGTCGAGG - Intronic
1135588380 16:23688596-23688618 GGGCCACATGTGTGGAGCAGAGG + Intronic
1136544700 16:30948613-30948635 AGGCCGGAGGGGTGGGGCCTGGG + Exonic
1136550402 16:30979715-30979737 GGGCCGCAGGGCTGGCGCAGGGG - Exonic
1137708317 16:50549687-50549709 GGGTCGCGTTGGTGGGGCAGGGG - Intronic
1139355380 16:66364422-66364444 GGGCCCCAGGGGTGGGGCTGGGG - Intergenic
1139356815 16:66371641-66371663 GGGCCTCAGGGGTGGGGCAGAGG - Intronic
1142028478 16:87826926-87826948 GGGCCCCTTGGGTGGGGCGCAGG - Intergenic
1142065082 16:88057737-88057759 GGGCCATCTGGGTGGGGCGGGGG + Intronic
1142144784 16:88488281-88488303 GGGCCGCATGGGGGCGGGGGTGG + Intronic
1142284732 16:89167144-89167166 TGGCCACAGGGGTGGGGACGTGG - Intergenic
1143103902 17:4519085-4519107 GGCAGGCATGGGTGGGGCGGGGG - Intronic
1143274253 17:5698334-5698356 GGGCCGCATGAGCAGGACCGTGG - Intergenic
1143629044 17:8126640-8126662 GGGCCGGCTGGGCGGGGCGGCGG + Intergenic
1143876736 17:9997235-9997257 GGGCCGGGCGGGTGGGGGCGGGG + Intronic
1143966934 17:10762232-10762254 GGGCTGCCTGGCTGGGGCTGTGG + Intergenic
1144196673 17:12901436-12901458 AGGACTCATGGGTGGGGCCATGG + Intronic
1144482556 17:15639790-15639812 GGGGGGCCTGGGTGGGGCCCAGG - Intronic
1144850778 17:18242823-18242845 GTGCTGCAGGGGTGGGGCCCTGG + Intronic
1144916127 17:18725241-18725263 GGGGGGCCTGGGTGGGGCCCAGG + Intronic
1147611740 17:41805817-41805839 GGGTTGGATGGGTGGGGGCGTGG + Intronic
1147752552 17:42745055-42745077 ACGGCGCAGGGGTGGGGCCGCGG - Intergenic
1147793035 17:43025171-43025193 CGGCCGCCTGGCTGGGGGCGGGG + Intergenic
1147933310 17:43996309-43996331 GGACAGCAAGGGTGGGGCCTGGG - Intronic
1147994804 17:44354737-44354759 GGGCCACAAGGGGGCGGCCGAGG - Exonic
1148108441 17:45131778-45131800 TGGCCGCCTCTGTGGGGCCGCGG + Intronic
1148769045 17:50056445-50056467 GGGGCGCGCGGCTGGGGCCGGGG - Exonic
1148788912 17:50162073-50162095 GGGCCGCAGGAGTGAGGCGGAGG + Intergenic
1149610455 17:57955126-57955148 GGGCCGCTGGGCCGGGGCCGCGG + Intronic
1149610499 17:57955255-57955277 GGGCCGCAGGGGCCGGGCCGCGG + Exonic
1149870657 17:60178420-60178442 CCTCAGCATGGGTGGGGCCGGGG + Intergenic
1150131537 17:62671883-62671905 GGACAGGATGGGTGGGGCAGTGG - Intronic
1150226067 17:63525015-63525037 TGGCAGCATGGGTGGGAACGAGG + Intronic
1150571074 17:66387770-66387792 GAGCCGCAGGGGTAGGGCAGAGG + Intronic
1151568950 17:74916475-74916497 GGCCCCCATGGCTGGGGCAGGGG - Exonic
1152138899 17:78524973-78524995 ACGCCGCGTGGGTGGGGCCCGGG - Intronic
1152268373 17:79309436-79309458 GGCCCCCATGGGTGGGGCAGAGG - Intronic
1152273719 17:79341547-79341569 AGGCAGCATGGCTGGGGCTGGGG + Intronic
1152321009 17:79608921-79608943 GGGCGGCATGGCGGGGGCGGAGG - Intergenic
1152655053 17:81515330-81515352 GGACCGCATGGATGGAGCTGGGG + Intronic
1153131617 18:1860261-1860283 GGGCAGCATGGGTTGGGGAGAGG + Intergenic
1160204504 18:76822284-76822306 GGGGCGCATGCGCGGCGCCGCGG - Exonic
1160710551 19:549190-549212 GGGGCGCCCGGGTGGGGCTGGGG + Intronic
1160875861 19:1295932-1295954 GGACCACTGGGGTGGGGCCGGGG + Intronic
1160961868 19:1725723-1725745 GGGGCGCATGCGCGGGGCCGCGG + Intergenic
1160967906 19:1754551-1754573 GGGCCGCACGGGGGAGGCGGCGG + Exonic
1160990237 19:1857423-1857445 GGGCAGTGTGGGCGGGGCCGCGG + Intronic
1161007854 19:1945280-1945302 GGGCCGCCTGAGTGCTGCCGGGG - Intronic
1161015466 19:1980764-1980786 GGAAGGCAGGGGTGGGGCCGTGG + Exonic
1161331866 19:3692390-3692412 GGGCAGCATGGGGGCCGCCGGGG - Intronic
1161516630 19:4700085-4700107 GGGCGGCAGGGCTGGGGCCTGGG + Intronic
1161768142 19:6217912-6217934 GGGGGGCACGGATGGGGCCGGGG - Intronic
1162552535 19:11365550-11365572 GGGGGGCATGGGTGGAGCAGAGG + Exonic
1162896078 19:13765279-13765301 GGGCCCCATCTGTGGGGCCCTGG - Intronic
1163021421 19:14482809-14482831 GGGCCGCAGGGCTGGGGGAGGGG + Exonic
1163508021 19:17719684-17719706 GGGCCGGCGGGGTGGGGCGGCGG + Intronic
1163767246 19:19170443-19170465 GGGCGCCATGGGTGGGGGCGCGG + Intronic
1163807042 19:19405796-19405818 GGGCTCCATGTGTGCGGCCGAGG + Intronic
1164305562 19:24002370-24002392 AGGCCGCATGTGAGGGGCAGGGG - Intergenic
1164643935 19:29844732-29844754 GGGCCGAAGAGGTGGGGGCGGGG + Intergenic
1165023668 19:32943875-32943897 GGGACGCATGTGGGGGTCCGTGG + Intronic
1165433397 19:35784623-35784645 GGGGAGTCTGGGTGGGGCCGGGG - Intronic
1166083263 19:40458295-40458317 GGGTGGCAGGGGCGGGGCCGGGG + Intronic
1166219148 19:41353960-41353982 GCGCTTCCTGGGTGGGGCCGGGG - Intronic
1166361169 19:42253661-42253683 GGGCCCTGGGGGTGGGGCCGGGG - Intronic
1166382372 19:42361801-42361823 GGGCTGCAGGGGTGGGGAGGAGG + Intronic
1166678675 19:44754557-44754579 GGGCCGCAGGGGGTGGGGCGGGG - Intronic
1166873148 19:45882830-45882852 AGGCCGCAGGGGTGGGGGCTGGG + Intergenic
1166888025 19:45973343-45973365 GGGCTCCATGGGGGGGGCCTGGG + Exonic
1166898134 19:46036710-46036732 GGGCCTCATGGCTGGGGGCTGGG + Intergenic
1167334425 19:48875760-48875782 GGGCAGCAGGGGTGAGGCAGGGG - Exonic
1167368100 19:49065103-49065125 GGGCGGCAGAGGAGGGGCCGGGG + Intergenic
1167396835 19:49235030-49235052 GGGCAGCAGGGATGGGGCTGGGG + Intergenic
1167414827 19:49364522-49364544 GGGCGTCTTGGGTGGGGGCGTGG + Intronic
1168290308 19:55354276-55354298 GGGCCGGGTTGGTGGGGGCGGGG - Exonic
1168296921 19:55381817-55381839 ATGCTGCATGGGTGAGGCCGAGG + Intronic
1168297605 19:55385006-55385028 ATGCCGCGTGGGTGAGGCCGAGG + Intergenic
1168340913 19:55622446-55622468 TGGCCACTTGGCTGGGGCCGAGG - Exonic
1168403687 19:56100026-56100048 AGGCCACAGGGCTGGGGCCGTGG + Intronic
925146667 2:1587195-1587217 GGGCCCTGTGGGTGGGGCCAGGG - Intergenic
926012989 2:9423266-9423288 AGGAAGGATGGGTGGGGCCGCGG - Intronic
926878909 2:17518615-17518637 GGGGCGCGTGGGTGGGGGCAGGG - Intergenic
927104060 2:19809251-19809273 GGGGGCCATGGGTGGGGGCGGGG - Intergenic
927215627 2:20666749-20666771 GGGCGGCAGAGTTGGGGCCGCGG - Exonic
927557598 2:24047151-24047173 GGGCCGCGTGTGAGGGGTCGCGG - Intronic
927702522 2:25277112-25277134 GGGCCGCGTGGGCGGGGACGGGG + Intronic
927847589 2:26479487-26479509 GGGCCGCATTGGTGGAGTGGAGG + Exonic
927866056 2:26588355-26588377 GGGCAGCCTGGGAGGGGCTGGGG + Intronic
929938577 2:46313287-46313309 CAGCCTCATGGGTGGGGCTGAGG - Intronic
930872707 2:56184477-56184499 GGGCCGCTGGGTTGGGGCGGCGG - Exonic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
932246674 2:70202405-70202427 GGGCCCCAAGGGTGGGCCCAGGG + Intronic
934954789 2:98608526-98608548 GGGCCGCGGCGGTAGGGCCGAGG + Intergenic
937084084 2:119159018-119159040 GGGGCGCGTGAGTGTGGCCGCGG - Intergenic
937155662 2:119717103-119717125 GGGCCTCAGGGGTGGGGCAGAGG + Intergenic
937338077 2:121074389-121074411 GGGCCCCAGGGGAGGGGCAGAGG - Intergenic
937913894 2:127089629-127089651 GGGGCAGGTGGGTGGGGCCGGGG - Intronic
940971970 2:159904793-159904815 GGGCGGCGGGGGCGGGGCCGGGG - Intergenic
941580595 2:167292753-167292775 GGCCCGCAGGGGTGGGCCTGGGG - Intergenic
942067289 2:172283773-172283795 AGGCCTCGGGGGTGGGGCCGGGG + Intergenic
943692446 2:190881702-190881724 GGGTCGCCCTGGTGGGGCCGCGG + Intronic
944839658 2:203612781-203612803 GGGCCCCATTTGTGGGGCCTGGG + Intergenic
946247995 2:218398167-218398189 CGGCCCCCTGGGTGGGGCCTCGG - Intergenic
946591651 2:221256000-221256022 GGGATGCATGTGTGGGGGCGGGG - Intergenic
947662665 2:231881743-231881765 CTGCAGCATGGGAGGGGCCGAGG - Intergenic
947812512 2:233013337-233013359 GGGCCCCATGGGTTGAGCCAGGG + Intronic
948240579 2:236429710-236429732 GGGCCACTTGGGTGGGTCGGTGG + Intronic
948845444 2:240680737-240680759 GGGCAGCATGGGCGGGGCACGGG - Intronic
948848417 2:240694142-240694164 GGGCAGCATGGGCGGGGCACGGG + Intronic
948893078 2:240916444-240916466 GGAGCGCATGGGGGGGGCGGGGG - Intergenic
949069874 2:242018056-242018078 GGGACGCAGGGGAGGGGCTGGGG + Intergenic
949069883 2:242018076-242018098 GGGACGCAGGGGAGGGGCTGGGG + Intergenic
949069892 2:242018096-242018118 GGGACGCAGGGGAGGGGCTGGGG + Intergenic
1169208740 20:3754194-3754216 GGGCCGCATGGGTGGGGCCGGGG - Intronic
1169265007 20:4162157-4162179 GGGCGGCCCGGGTGGGGCTGGGG + Intronic
1170584353 20:17723157-17723179 GGGCTGCAGGGGTGGGGCTGGGG - Intronic
1171467254 20:25338448-25338470 GGGCCGCATCTGTGGGTTCGAGG - Intronic
1172185078 20:33026487-33026509 GGGCCAGATGGGTGGGGGCATGG + Intergenic
1172196493 20:33095310-33095332 GACCCCCATGGGTGGGGGCGGGG + Intronic
1174298940 20:49568272-49568294 GGTCCGCAGGGGTCGGACCGGGG + Intergenic
1174425285 20:50427832-50427854 GGGGTGCCTGGGTAGGGCCGTGG - Intergenic
1175155454 20:56968118-56968140 GGACAGCATGGGCGGGGCTGGGG + Intergenic
1175300294 20:57938123-57938145 CGGCAGCATGGGTGGGGTGGGGG + Intergenic
1175316893 20:58054892-58054914 GGGCCAGACGGGAGGGGCCGAGG + Intergenic
1175387834 20:58608589-58608611 GGGTCGCATGTGTGGGCCTGGGG + Intergenic
1175840166 20:62021555-62021577 GGGCTGCGTGGGCTGGGCCGGGG + Intronic
1175892720 20:62322615-62322637 GGGCTGGGTGGGTGGGGCCTAGG - Intronic
1175999996 20:62827400-62827422 GGGCTGCCTGGGTGGGCCTGGGG + Intronic
1178467083 21:32858733-32858755 GGGCCTGATGGCTGGGGGCGAGG - Intergenic
1179903438 21:44406830-44406852 GGGCCGCATGAGTGGGAGTGAGG + Intronic
1179919322 21:44499103-44499125 GGTCCCTGTGGGTGGGGCCGTGG + Exonic
1179970862 21:44836186-44836208 GGGCTGCAGGGGTGGGGTGGGGG - Intergenic
1179982441 21:44903353-44903375 CGGCCGCATTGGTGAGGCCCAGG - Exonic
1180090968 21:45533691-45533713 GGGCAGCACGAGTGGGGCTGTGG - Intronic
1180614761 22:17120209-17120231 GGGCGGCCTGGGGGCGGCCGCGG - Exonic
1180842560 22:18966111-18966133 AGGCCGGCTGGGTGGGGCTGGGG - Intergenic
1180881240 22:19204912-19204934 GGGCCGGCTGGGTGGGGCAGAGG - Intronic
1180980583 22:19876354-19876376 GGGCTGCAGGGCAGGGGCCGGGG - Intronic
1180982537 22:19885577-19885599 GGGCCCCATGGGCAGGGCTGGGG + Intronic
1181051084 22:20238613-20238635 GGGCCGCAGGGGTGGAGTCGGGG + Intergenic
1181055354 22:20258313-20258335 GGGTGGCAGGGGTGGGGCTGGGG - Intronic
1181172103 22:21015563-21015585 GTGCCCCCTGGGTGGGGCCTGGG - Intronic
1181177203 22:21044641-21044663 GTGCCCCCTGGGTGGGGCCGTGG + Intergenic
1182696090 22:32200243-32200265 GGCCCCCATGGGTGGGGCGAGGG - Intronic
1183457903 22:37932698-37932720 GGGCCTGCTGGGTGGGGCTGGGG + Intronic
1183513757 22:38251174-38251196 GGCCAGCATGGGTTGGGCTGCGG - Intronic
1183538645 22:38417288-38417310 GGACGGCAAAGGTGGGGCCGTGG - Intergenic
1183597610 22:38822048-38822070 GGGAGGCATGGGTGGGGGGGGGG + Exonic
1184139703 22:42571397-42571419 GGGCAGCAGGGGATGGGCCGGGG + Intronic
1184388933 22:44192119-44192141 AGGGCCCATGGGTGGGGCTGGGG + Intronic
1184551338 22:45205765-45205787 GGGTGGGATGGGTGGGGCTGCGG - Intronic
1184590283 22:45477498-45477520 GGGCAGCATGGGTGAGGGCTGGG - Intergenic
1184650524 22:45917506-45917528 TGGCCCCTTGGGAGGGGCCGTGG - Intergenic
1184730040 22:46366898-46366920 GGGCCGCAGGACTGGGGCTGAGG + Intronic
1184852407 22:47128197-47128219 GGGGGGGATGGGTGGGGCGGAGG - Intronic
1184852424 22:47128229-47128251 GGGGGGGATGGGTGGGGCGGAGG - Intronic
1185098077 22:48822413-48822435 GGGTCCCATGGGTGGGCCTGTGG - Intronic
1185168711 22:49278450-49278472 GGGCCCCATGGAAGGGGCAGCGG - Intergenic
1185329359 22:50245297-50245319 GGGCGCGATGGGTGGGGCGGGGG + Exonic
950211499 3:11126838-11126860 GGGCAGCATGGGTGGGTCAGTGG + Intergenic
950455770 3:13091912-13091934 GGGCAGCTTGGGTGGGGTCGGGG + Intergenic
950498921 3:13352008-13352030 GGGCCGCATGTGGGAGGGCGAGG + Intronic
950578431 3:13847001-13847023 AGGCCGCATGGGTAGGGGCAGGG - Intronic
954146872 3:48638871-48638893 GGGCCCTAGGGGTGGGGCAGGGG - Intronic
954648461 3:52145390-52145412 GGCCAGCATTGGTGGGACCGTGG - Intronic
957056397 3:75446220-75446242 GGGCAGCATTGGTTGGGCGGGGG + Intergenic
958715436 3:97774489-97774511 TGGCAGCATGGGTGGGGGAGGGG + Intronic
959281611 3:104348500-104348522 GGGCCTCATGGGAGGGTCCAGGG + Intergenic
959907783 3:111729720-111729742 GGACAGCATGGGTGGGGAGGAGG + Intronic
961003252 3:123388237-123388259 GGGCAGGTTGGGAGGGGCCGCGG + Intronic
961297987 3:125902490-125902512 GGGCAGCATTGGTTGGGCGGGGG - Intergenic
961664682 3:128488150-128488172 GGGCTGCAGGGGTCGGGCCTTGG - Intronic
961666849 3:128497959-128497981 GGGTCGCCGGGCTGGGGCCGGGG - Intergenic
961746288 3:129065405-129065427 CGGCCGGATGGGTGGGTCAGTGG - Intergenic
964786290 3:160399899-160399921 GGGCCGCCGGGGAGCGGCCGAGG - Intronic
968106803 3:196007108-196007130 GGGACGCAGGGGAGGGGCTGGGG - Intergenic
968601605 4:1512501-1512523 GGGGCGCCGGGGTGGGGCCTGGG + Intergenic
968915634 4:3496000-3496022 GGGCCTCGTGGGTGGGGGCTGGG - Intronic
968999211 4:3966498-3966520 GGGCAGCATTGGTTGGGCAGAGG + Intergenic
969814687 4:9678417-9678439 GGGCAGCATTGGTTGGGCGGGGG - Intergenic
971358292 4:25914110-25914132 GGGCCTCAAGGCTGGGGGCGGGG - Intronic
971424817 4:26505181-26505203 GGGCGGCATGAGAGGGGCAGGGG + Intergenic
972351159 4:38237040-38237062 GTGGGGCATGGGTGGGGCCAGGG + Intergenic
973907480 4:55546429-55546451 GGGCGGCGTGTGTGGGGCCGGGG - Intronic
978789455 4:112645608-112645630 GGATCGCTTGGGTGGGGCTGAGG - Intronic
979766682 4:124472220-124472242 TGGCAGCATGGGTGGGGGAGGGG - Intergenic
980532134 4:134070182-134070204 GTGCTGCATTGGTGGGGCCTAGG + Intergenic
984801822 4:183723035-183723057 GGGCCGCCAGGGAGCGGCCGTGG + Intergenic
985387647 4:189463921-189463943 GGCCCTCATGGGTCGGGCCTGGG - Intergenic
985566395 5:620477-620499 AGGGCGCAGGGCTGGGGCCGTGG + Intronic
985656687 5:1135485-1135507 GGGCAGCAGGGCTGGGGACGAGG - Intergenic
990376200 5:55173307-55173329 GGCCGGCAGGGGCGGGGCCGCGG - Intergenic
994127885 5:96190163-96190185 GGGCAGCCAGGGTGGGGCTGGGG + Intergenic
997654169 5:135543603-135543625 CGGCGGCAAGGGTGGGGGCGCGG - Intergenic
997955359 5:138274625-138274647 GGACCGCGGGGGTGGGGGCGGGG + Exonic
999158377 5:149474610-149474632 GGGCCACATTGCTGGGGCCTGGG - Intergenic
999382652 5:151132304-151132326 GGGCAGCATGGCTGAGGCTGGGG - Intronic
1001920648 5:175596811-175596833 GGGCCGCAGCTGTGGGGCCAGGG - Intergenic
1002836526 6:869393-869415 GGGCTGCATGGTTGTGGCAGGGG + Intergenic
1003218407 6:4135711-4135733 GGGGCTCGGGGGTGGGGCCGGGG + Intergenic
1003218466 6:4135876-4135898 GGGGCTCGGGGGTGGGGCCGGGG + Intergenic
1003551736 6:7107395-7107417 GGGCTGCAGGGGAGGGGGCGCGG + Intergenic
1004194002 6:13487778-13487800 AGGCGGCCTGGGCGGGGCCGGGG - Intergenic
1005928625 6:30464687-30464709 GGACCGCAGGGTTGGGGCCCAGG + Intergenic
1006882855 6:37354561-37354583 GGGCCACAAGGGTTGGGGCGAGG + Intronic
1007353743 6:41294786-41294808 TGGCAGCATGGCTGGGGCAGGGG - Intergenic
1007391340 6:41551249-41551271 GGGCCGCAGGTGTTGGACCGTGG + Intronic
1010215222 6:73395178-73395200 GGGCAGGATAGGTGGGGCCAGGG + Intronic
1010622912 6:78099410-78099432 TGGCAGCATGGGTGGGGGAGGGG + Intergenic
1010786239 6:80004487-80004509 GCGCCGCACGGGTGGGGTCGCGG + Intronic
1012137487 6:95577472-95577494 GGGCGGGACGGGTGGGGGCGGGG - Intergenic
1015625775 6:135180517-135180539 GGGCGGGGTGGGTGGGGCCCGGG + Intergenic
1017682254 6:156876303-156876325 GGGCCGGATGGGTGAGGCTGAGG - Intronic
1018813742 6:167316406-167316428 GGGGGGCAGGGGTAGGGCCGGGG - Intergenic
1019062616 6:169266875-169266897 GGCCCCCAGGGGTGGGGCAGGGG + Intergenic
1019324540 7:431813-431835 CGGCCCCATGGCTGGGGCTGTGG + Intergenic
1019479583 7:1260324-1260346 GGGCCGGATGGGTGAGCCTGGGG - Intergenic
1019516128 7:1440932-1440954 CTGCCGAATGGGTGGGGACGTGG + Intronic
1019703823 7:2488087-2488109 GGGCCTCCTGGCTGGGGGCGGGG - Intergenic
1022923420 7:35037699-35037721 GGGCGGCGGGGGCGGGGCCGCGG - Intronic
1024044207 7:45576023-45576045 GGGCCGCAGGGATGGGGCTGGGG + Intronic
1024555400 7:50599163-50599185 CAGCTGCATGGGTGGGGACGGGG + Intronic
1025023493 7:55497735-55497757 GGGCCGCATGGCTGGTCCGGTGG - Intronic
1026840562 7:73668168-73668190 GGGCCGCGCGGGCCGGGCCGCGG + Intronic
1027177667 7:75915077-75915099 CGGCCGCGGGGGTGGGGGCGTGG - Exonic
1027199969 7:76057778-76057800 GGTCTGCATGGGTGGAGCAGGGG - Intronic
1032083185 7:128870046-128870068 GGGCCGCCCGGGAGGGGGCGTGG - Intronic
1032490685 7:132321856-132321878 GGGAAGCCTGGGTGGGGCGGAGG + Intronic
1035249613 7:157588383-157588405 GGGAGGCAGGGGAGGGGCCGCGG - Intronic
1035583218 8:753170-753192 GGGCCGGATGGGTGTTGCTGCGG + Intergenic
1035638341 8:1163644-1163666 CGGCCGCCTGGGGAGGGCCGGGG + Intergenic
1036378026 8:8217449-8217471 GGGCAGCATTGGTTGGGCGGAGG - Intergenic
1036635710 8:10548442-10548464 GGCCCTCACGGGTGGGGCCCTGG + Intronic
1037550022 8:19961502-19961524 GGTACACATGGGTGGGGCTGCGG - Intronic
1038544041 8:28412079-28412101 GGCGCGCAGGGGTGGGGCGGAGG - Intronic
1039473857 8:37829176-37829198 GGAACACATGGGTGGGGCCAGGG - Intronic
1040323147 8:46328545-46328567 GGGCCCCATGGGTGGTGGTGGGG - Intergenic
1041016054 8:53594373-53594395 GCGCCGCATCAGTGGGGCCTTGG - Intergenic
1041330253 8:56716504-56716526 GAGCAGCAGGGGTGGGGCTGGGG - Intergenic
1041910750 8:63086087-63086109 CGGCCGCAGAGGCGGGGCCGAGG - Intergenic
1043476568 8:80611239-80611261 GGGCTGGGTGGGTGGGGCCCAGG + Intergenic
1047168612 8:122467276-122467298 AGGCAGCATGGCTGGGGCAGTGG - Intergenic
1047330275 8:123880631-123880653 GTGCCGCAAGGTTGGGGACGTGG - Intronic
1049229112 8:141473001-141473023 GGGCCGAGTGGGCGGGGCCTGGG - Intergenic
1049238595 8:141525241-141525263 GGACGGCAAGGCTGGGGCCGGGG + Intergenic
1049572627 8:143376368-143376390 GCCCCCCATGGGTGGGGCAGGGG - Intronic
1049645337 8:143733525-143733547 CGGCCGCGTGCGCGGGGCCGGGG - Intronic
1049749361 8:144276087-144276109 GGGCCGCACTGTTGGAGCCGAGG - Intronic
1050382344 9:5042794-5042816 GGAACGGAGGGGTGGGGCCGCGG + Intronic
1050437858 9:5628978-5629000 GCGCCGCGTGGGTCGGGCCGGGG - Intergenic
1051279047 9:15423035-15423057 GGGCCGTCTGCGCGGGGCCGGGG + Exonic
1057203830 9:93158842-93158864 TGGCTGCCTGGGTGGGGCAGTGG - Intergenic
1057259588 9:93576424-93576446 GGGTCCCTTCGGTGGGGCCGCGG + Exonic
1057928112 9:99170749-99170771 GGGGAGCAGGGGTGGGGCTGGGG + Intergenic
1058058723 9:100473841-100473863 GGGTCCCAGGGGTGGGCCCGAGG + Intronic
1058866650 9:109167171-109167193 GGGCCGCAGCGGGGGCGCCGCGG + Exonic
1060551596 9:124488046-124488068 TGGCTGCAGGGGTGGGGACGGGG - Intronic
1060552697 9:124492997-124493019 GGGGCCCAGGGGCGGGGCCGAGG + Intronic
1061181780 9:129028518-129028540 GAGCTACATGGGTGGGGGCGAGG + Intergenic
1061793571 9:133071265-133071287 GGGCGGCACGGGGGGGGCCCCGG - Exonic
1061793587 9:133071298-133071320 GGGCGGCACGGGGGGGGCCCCGG - Exonic
1061793603 9:133071331-133071353 GGGCGGCACGGGGGGGGCCCCGG - Exonic
1061793619 9:133071364-133071386 GGGCGGCACGGGGGGGGCCCCGG - Exonic
1061793635 9:133071397-133071419 GGGCGGCACGGGGGGGGCCCCGG - Exonic
1061793651 9:133071430-133071452 GGGCGGCACGGGGGGGGCCCCGG - Exonic
1061793667 9:133071463-133071485 GGGCGGCACGGGGGGGGCCCCGG - Exonic
1062020316 9:134316279-134316301 GGGCTGCATGGGTGGGGGGAGGG - Intergenic
1062061974 9:134501760-134501782 GGGCAACTTGGGTGGGCCCGTGG + Intergenic
1062284127 9:135765564-135765586 GGGCCGCCCGGGCGGGGCAGGGG + Intronic
1062448065 9:136604047-136604069 GTGACTCGTGGGTGGGGCCGAGG + Intergenic
1062448294 9:136604883-136604905 GGGTGGCCTGGGTGGGGCTGGGG - Intergenic
1062454205 9:136628035-136628057 GCGCCACATGGATGGGGCCGGGG + Intergenic
1062493584 9:136821393-136821415 GGGCCGCCTGAGCGGTGCCGGGG + Intronic
1062522471 9:136963989-136964011 GGGCTGCAGGGCTGGGGCTGGGG + Intergenic
1062527347 9:136983328-136983350 CGGCTGGATGGGTGGGGCTGTGG - Exonic
1062562511 9:137147947-137147969 GGGTCGTAGGGGCGGGGCCGTGG - Intronic
1062689155 9:137832532-137832554 GGGCCACATGGGTGGGTGGGGGG - Intronic
1203577853 Un_KI270745v1:21893-21915 TGTCCACATGGGAGGGGCCGGGG - Intergenic
1189002902 X:36964025-36964047 CGGCCGCGTGGGTGGGGGCGCGG + Intergenic
1189331709 X:40148298-40148320 AGCCCGCGGGGGTGGGGCCGTGG - Intronic
1192661906 X:73050344-73050366 TGGCAGCATGGGTGGGGGAGGGG + Intergenic
1193915207 X:87354795-87354817 TGGCAGCATGGGTGGGGGAGGGG + Intergenic
1195672848 X:107484013-107484035 GGGCTGCAGGGGAGGGGCTGTGG + Intergenic
1197446031 X:126552862-126552884 GGGCCGAGTGGGAGGGGCGGAGG + Intergenic
1198369188 X:135974229-135974251 GGGGAGGATGGGTGGGGCCGAGG + Intergenic