ID: 1169210780

View in Genome Browser
Species Human (GRCh38)
Location 20:3765246-3765268
Sequence CTGTGGACACAGCTGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 379}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169210780_1169210785 12 Left 1169210780 20:3765246-3765268 CCCTGCTGCAGCTGTGTCCACAG 0: 1
1: 0
2: 2
3: 32
4: 379
Right 1169210785 20:3765281-3765303 CCACCACACAACCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 31
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169210780 Original CRISPR CTGTGGACACAGCTGCAGCA GGG (reversed) Intronic
900106379 1:982975-982997 CCGAGGACACAGATGCAGAAAGG - Intergenic
900121756 1:1051324-1051346 CAGAGGACACGGCAGCAGCACGG - Exonic
900293905 1:1939032-1939054 ATGTGGACACACGTGCGGCAGGG + Intronic
900333763 1:2150507-2150529 CTCTGGTCACAGCTGCAGGTGGG - Intronic
900790011 1:4673654-4673676 CTGTGGACACAGACGCGGCCAGG + Intronic
900852057 1:5151693-5151715 CTGGGGAGGCAGCTGCAGCCAGG + Intergenic
901405179 1:9040348-9040370 CTCGGGAAACACCTGCAGCAGGG + Intronic
901595628 1:10383225-10383247 CTGAGGACACTGCTGCCTCAAGG - Intergenic
901755576 1:11439616-11439638 CTGTGGGCTCATCTCCAGCAGGG + Intergenic
902246157 1:15122185-15122207 CTTTGGACACAGCTGGCGCCAGG + Intergenic
902515348 1:16986838-16986860 CCTTGGACACGGCTGCAGCCAGG + Exonic
902554715 1:17240152-17240174 CTGTGGGAACAGGTGAAGCAAGG + Intronic
904337096 1:29805053-29805075 CAGTGGGCACAGCAGCAGCTGGG - Intergenic
905242449 1:36589651-36589673 CTGTCCACACAGCTTCAGCCAGG - Intergenic
905245927 1:36613264-36613286 CTGTGGCCACAGAGGCAGAAAGG - Intergenic
906194962 1:43924291-43924313 CTGTGGACAAAGCAGCAAGAAGG - Intronic
906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG + Intergenic
907460641 1:54603564-54603586 ATGAGGACACAGCAGCACCAGGG + Intronic
909792121 1:79693059-79693081 CTGTGGAGTCACCAGCAGCATGG - Intergenic
910229633 1:84972993-84973015 CTTTGGAGACAACTGCAGCAGGG - Intronic
911105574 1:94128846-94128868 CAGTGGCCACAGCAGCTGCAGGG + Intergenic
912204164 1:107492319-107492341 CTGGTGACACAGCTGCAGAGAGG + Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
914756258 1:150563048-150563070 AGGTGCTCACAGCTGCAGCATGG + Intergenic
914921019 1:151847579-151847601 CTAGGGACACAGATGAAGCAAGG - Intronic
915602996 1:156934017-156934039 CTGTGGAGCCAGCTTCACCAGGG + Intergenic
918239005 1:182605417-182605439 CTGAAGACCCAGCTGCAGGAAGG + Intergenic
919991181 1:202709575-202709597 TTGGGGACAGAGCTGAAGCAGGG + Intronic
920361454 1:205419585-205419607 CTGTGGTCCCAGCTGCTGGAGGG - Intronic
1063046497 10:2397942-2397964 CTGTGATCACTACTGCAGCAGGG - Intergenic
1063370971 10:5523098-5523120 CTGTGGACAGAGCTGTAACCTGG + Intergenic
1067267452 10:44757691-44757713 CTCAGGGCACAGCTGCAGCCTGG + Intergenic
1068140149 10:52995868-52995890 CTGTGAACATAGCTACAGCCAGG + Intergenic
1069979917 10:72245266-72245288 CTGTGGCCACAGAGTCAGCAGGG - Intergenic
1070586301 10:77769359-77769381 CTGTGCACTCAGCTTTAGCAGGG - Intergenic
1070774347 10:79101089-79101111 GTGTGGACTTGGCTGCAGCAAGG + Intronic
1071495476 10:86164855-86164877 CTGGGGGCACATCAGCAGCATGG + Intronic
1071797925 10:89025955-89025977 TTGTGGATGCTGCTGCAGCAAGG + Intergenic
1073458688 10:103653067-103653089 CTGTGGAGACGTCAGCAGCAGGG - Intronic
1074175274 10:110994246-110994268 CTATGGCCACTGCTACAGCAAGG - Intronic
1075727725 10:124619068-124619090 CCATGGCCACAGCTGCATCATGG - Intronic
1075860115 10:125667839-125667861 CAGTGGACTCATCTGCAGCCAGG + Intronic
1076259745 10:129055886-129055908 CAGTGAACACAGCGGCAGGAGGG + Intergenic
1076721251 10:132394314-132394336 CTGTAGGCACAGCCGCAGCAAGG - Intergenic
1076990718 11:272100-272122 ACCTGGACACAGCTGCAACATGG - Intergenic
1077169654 11:1160533-1160555 CTGCGGCCACAGATGCAGCATGG - Intronic
1077323312 11:1952188-1952210 GTGCGGACACGGGTGCAGCATGG + Exonic
1077875189 11:6298805-6298827 CTGTTCACAGAGCTGCAGCCTGG - Intergenic
1077890982 11:6418540-6418562 CTGGGGACACAGCCGCCCCAGGG + Intronic
1080646026 11:34188308-34188330 CTGAGGACACAGCAGGAACAGGG + Intronic
1080703730 11:34668453-34668475 CTGTTTTCACAGCTTCAGCAGGG - Intergenic
1081394510 11:42569723-42569745 CTGTAAACAAAGCTCCAGCATGG + Intergenic
1081802268 11:45868133-45868155 CTGTGGACACAGCTCCAGAGCGG - Intronic
1085269156 11:75259975-75259997 CTGTGGCCCCAGCTCCAGCCTGG - Intergenic
1085689397 11:78653108-78653130 CTCTTGACAGAGCTGCAGCCTGG + Exonic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1089327361 11:117666516-117666538 CTGAGGACAAAGCTGCTGCCGGG + Intronic
1090670096 11:128940031-128940053 CTATGGTCAGAGCTGGAGCAAGG - Intronic
1202806300 11_KI270721v1_random:7383-7405 GTGCGGACACGGGTGCAGCATGG + Intergenic
1092238556 12:6824110-6824132 CTGACGACGCAGCTGCACCACGG - Exonic
1095197116 12:39332970-39332992 CTGTCGAAACAGATGCATCAAGG - Exonic
1096741820 12:53699067-53699089 CTGTGGATGCAGCTGCTCCAGGG - Intergenic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1100524703 12:95408413-95408435 CTGTGCTCACAGGAGCAGCATGG + Intergenic
1102058702 12:109915832-109915854 CTGTGGCCACAGCTGCTGAGAGG + Intronic
1102157780 12:110744209-110744231 TGGTGGACAGAGCTGTAGCAGGG - Intergenic
1103468487 12:121161114-121161136 CTGGGGACAGAGCCGAAGCATGG - Intronic
1104628301 12:130377740-130377762 CTGTGGCCTCAGCTGTGGCAGGG + Intergenic
1104982692 12:132581365-132581387 CTGTGAACAGAGCTGCAGATGGG + Intronic
1105730850 13:23213926-23213948 GTGTGGCCTCAGCTGCAGGAAGG + Intronic
1105896784 13:24723355-24723377 CTGTGGATGCTGCTGCAGCCTGG + Intergenic
1106076448 13:26465106-26465128 TTCTGGACACTGCTGCAGCATGG + Intergenic
1107574264 13:41700059-41700081 ATGTGGGCACCGCTGAAGCAAGG + Intronic
1108010234 13:45999346-45999368 TTGTTGACAAAGCAGCAGCAGGG - Intronic
1108118699 13:47160182-47160204 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1108555178 13:51584612-51584634 CTGAGGAGACTGCTGGAGCACGG - Exonic
1109982199 13:69923857-69923879 CTGGGCCCACAGCTGCAGCTTGG - Intronic
1110220816 13:73070911-73070933 CTGTGGACCCTCCTGCAGCAGGG - Intronic
1110391322 13:74978087-74978109 CTATTCACACAGCTGTAGCAAGG + Intergenic
1110548905 13:76789947-76789969 CTCTGGCCACATCTGCAGGAGGG - Intergenic
1112299430 13:98216764-98216786 TTGTGGAAACAGCTACAGAATGG - Intronic
1112666382 13:101579303-101579325 CTGTGGAAACTGCTACTGCAAGG + Exonic
1113076918 13:106475945-106475967 GTCTGGACCCAGCAGCAGCACGG + Intergenic
1113578724 13:111413522-111413544 CTCTGCACACTTCTGCAGCAAGG - Intergenic
1113723848 13:112582556-112582578 CACTGGACACTGCTGCTGCAGGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1113999786 14:16403328-16403350 CTGTGGACTCAGATTCAGCCAGG - Intergenic
1114131645 14:19799980-19800002 GTCTGGACAGAGCTGCAGCTAGG + Intronic
1114162726 14:20187335-20187357 CTCTGCACACTGCTGCAGAATGG + Intergenic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1115992393 14:39163535-39163557 CTGTGGAGACAGATTAAGCAAGG - Intronic
1115997801 14:39211896-39211918 CTGTGGCGACAGCTGCTGCCAGG + Intergenic
1117658666 14:57982405-57982427 CTGTGGACATAGCTGGTGCCTGG - Intergenic
1118458354 14:65965438-65965460 CTATGCACACAGCTGCTCCAAGG + Intronic
1119180873 14:72604629-72604651 CTGTGGACACAGATGACCCAGGG + Intergenic
1119429347 14:74555694-74555716 CTGTGGAGACAACCGCGGCACGG + Intronic
1119484882 14:74980806-74980828 CAGCGCACACAGCTACAGCACGG + Intergenic
1122408413 14:101513733-101513755 CTAGGGAGACAGCAGCAGCATGG - Intergenic
1122511043 14:102267816-102267838 TTGAGGACCCAGCTCCAGCATGG - Intronic
1123122866 14:105926240-105926262 CAGTGGACGGCGCTGCAGCAGGG + Intronic
1124442612 15:29698246-29698268 CTGTGTACACAGATGCATCCGGG - Intergenic
1125186673 15:36938945-36938967 CTGTCCACAGAGCTGCAGCGGGG - Intronic
1125515246 15:40315495-40315517 AGGTGGACACATCAGCAGCATGG - Intergenic
1125718006 15:41830630-41830652 CTGGGTCCACAGCTGCAGCTTGG - Intronic
1125732242 15:41899617-41899639 CTGTGGACACAGGTGAATGAGGG - Exonic
1126896786 15:53266335-53266357 CTGTGGTCACAGCTTTTGCAAGG - Intergenic
1127146722 15:56032582-56032604 CAGTGGCCACTGCTGCTGCAGGG - Intergenic
1127299945 15:57643249-57643271 CTGTGTACCCAGCCCCAGCACGG - Intronic
1129670139 15:77603216-77603238 GTGTGGTCTCAGCTGCAGGAAGG - Intergenic
1130353820 15:83112480-83112502 CAGTGGCCATAGGTGCAGCAGGG + Intronic
1130369379 15:83271343-83271365 GTTTGAACACAGCTGCAGCTAGG + Intronic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1131686583 15:94774372-94774394 CTTTGGTCACTACTGCAGCAAGG - Intergenic
1131998362 15:98155149-98155171 CTCTCCACACAGCAGCAGCATGG - Intergenic
1132365360 15:101252419-101252441 CTGCGGACAAAGCTGCAGTGTGG - Intergenic
1132372055 15:101306172-101306194 CTGAGGACACCGCTGCAGCAAGG + Intronic
1132394119 15:101459681-101459703 CTATGAACACAGCTCCAGCTGGG + Intronic
1132739483 16:1404315-1404337 CTGTGCACAGGGCTGCAGCCTGG + Intronic
1132897474 16:2235942-2235964 CTGGGGGCACAGCTCCAGCTGGG - Exonic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1132943102 16:2518230-2518252 CTGTGGACACAGCAGTGTCACGG - Intronic
1133165859 16:3946842-3946864 TTGGGGACACCCCTGCAGCAGGG + Intergenic
1133288345 16:4701786-4701808 CTATGGAAACAGCTGCTGCACGG + Intronic
1136355101 16:29739531-29739553 CTGTGAATTCAGCTTCAGCAGGG - Intergenic
1136409396 16:30067344-30067366 CAGTGGACTCATCTGCAGCCAGG - Exonic
1137406423 16:48192922-48192944 CCGTGGACACTGCAGCAGCTGGG + Intronic
1137456204 16:48619876-48619898 CTGTGGAGGCAGCTGCAGGGAGG - Intronic
1137456452 16:48621551-48621573 CTGTGGAGGCAGCTGCAGGGAGG - Intergenic
1138191936 16:55020786-55020808 CCTGGGACCCAGCTGCAGCATGG - Intergenic
1138199582 16:55078788-55078810 CTGTGGACAGAGTTTCAGAAGGG + Intergenic
1141570786 16:84932519-84932541 CAGTGGACACACCTGCTCCAGGG + Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142171338 16:88624294-88624316 CTGGGGACACGGCAGCAGCCGGG + Intronic
1142472655 17:172004-172026 CTGTGGACCCCTCTGCAGCCTGG - Intronic
1142860620 17:2758649-2758671 CAGGGGCCACAGCTGGAGCATGG - Intergenic
1144495882 17:15744501-15744523 CAGTGGCCAGAGCTGCAGCCTGG - Intronic
1144632025 17:16878710-16878732 CAGTGGCCACAGCTGCAGCCTGG + Intergenic
1145209001 17:20999463-20999485 CAGTGGCCAGAGCTGCAGCCTGG - Intergenic
1146363879 17:32203396-32203418 CTGTGGTCCCAGCTGCTCCAGGG - Intronic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1148467371 17:47872987-47873009 GTGTGGCCACAGCTGGAGAAGGG - Intergenic
1148808969 17:50278580-50278602 CTGTGGTGACAGCTGCTGCCAGG + Exonic
1149531772 17:57401551-57401573 TTGAGGACACAGCTGTAGCAGGG - Intronic
1150814027 17:68378588-68378610 CTGTGGACTCAGAGACAGCAGGG - Intronic
1151386989 17:73761016-73761038 CTGTGCACACAGCAACAGCTCGG - Intergenic
1151771622 17:76166383-76166405 CTGGGGCCACAGCTGCTGCCAGG + Intronic
1152288455 17:79425459-79425481 CTGTGGACACGGCTCCAGTCCGG - Intronic
1152383834 17:79957012-79957034 CTGTGGCCACAGCAGCAGGGAGG + Intronic
1152431771 17:80252222-80252244 CTGAGGTCACAGCTGAAGCTGGG + Intronic
1152719423 17:81915623-81915645 GTGTGGACACTGCTTCAGAAAGG - Exonic
1153767642 18:8389391-8389413 CTGTGGTCACAGCTGCCTCTGGG - Intronic
1156354863 18:36332239-36332261 CTGGGGCCACAGCTGCTGCAGGG - Intronic
1156569247 18:38233996-38234018 CTGAGGAGACAGCTGCATTATGG - Intergenic
1156928661 18:42614730-42614752 CTGTCTACACAGCTGCATCCTGG + Intergenic
1157222882 18:45839910-45839932 TTGTGGCCACAGCAGCAGCCAGG - Intronic
1157719784 18:49914843-49914865 CTTTGGATTCAGCTGCAGCATGG + Intronic
1157799058 18:50603594-50603616 CTGAGTCCACAGCTGCAGAATGG + Intronic
1158409093 18:57188574-57188596 CTGTGGACACAAGAGCAGAAAGG + Intergenic
1158517726 18:58144804-58144826 CTGTGGACATAGCAGTAGCAAGG - Intronic
1158750438 18:60253461-60253483 CCTTGGACACGGCTCCAGCAGGG + Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160171261 18:76557370-76557392 AGGTGGAAACAGCTGAAGCATGG - Intergenic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1162758587 19:12874798-12874820 CTGGGGGCACAGCTTCAGCAGGG - Exonic
1162925642 19:13929618-13929640 CAGAGGGCACAGCTGGAGCAGGG + Exonic
1164211160 19:23098499-23098521 CTGTGGACAGGGCTGAGGCAGGG - Intronic
1164424057 19:28124528-28124550 CTGTCCAGACAGATGCAGCAAGG - Intergenic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1166741062 19:45115088-45115110 CTGGGGACACAGCAGTGGCAAGG + Intronic
1167380814 19:49136943-49136965 CTGTGGAGTCAGCTCCGGCAGGG - Intronic
925025739 2:605938-605960 CTGGGGGCTCACCTGCAGCATGG - Intergenic
925119141 2:1403844-1403866 CTCTGCACGCAGCGGCAGCATGG + Intronic
925273822 2:2635136-2635158 CAGAGGACACAGCTGAACCATGG - Intergenic
925913360 2:8587484-8587506 CTGTGGCCACCGCGGCAGCACGG + Intergenic
927910803 2:26898291-26898313 ATCAGGACACAGCTGCAGTAAGG - Intronic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
929014464 2:37481240-37481262 CCCAGGTCACAGCTGCAGCAAGG - Intergenic
933800307 2:85955077-85955099 TTGTGTACACAACTTCAGCAAGG - Intergenic
933946195 2:87288299-87288321 TTGTGGACATTGCTGCAGTAGGG - Intergenic
934548468 2:95239347-95239369 TAGTTGACAAAGCTGCAGCAGGG + Intronic
934790699 2:97057553-97057575 ATGTGGACAAAACTGCAGAAAGG - Intergenic
934815758 2:97324976-97324998 ATGTGGACAAAACTGCAGAAAGG + Intergenic
934821937 2:97383507-97383529 ATGTGGACAAAACTGCAGAAAGG - Intergenic
936072787 2:109382518-109382540 CTGGGGACACAGCTGCAAGACGG - Intronic
936334015 2:111573272-111573294 TTGTGGACATTGCTGCAGTAGGG + Intergenic
936411672 2:112263795-112263817 CTGTCTTCACAGCTGCAACAAGG + Intergenic
937399037 2:121565432-121565454 ATGTGAACACAGCTGCTGCATGG - Intronic
937749421 2:125456741-125456763 CTGTGACCATAGCTGCAGCCTGG - Intergenic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
942591147 2:177548025-177548047 ATGTGGCCTCAGCTGCAGAATGG - Intergenic
943186668 2:184615822-184615844 CACTGGAAGCAGCTGCAGCAGGG + Intronic
943367785 2:186982053-186982075 CTGTGGCTGCAGCTGGAGCAAGG - Intergenic
948252193 2:236538414-236538436 CTGTGGCCACAGCGGAAGCCAGG + Intergenic
948841393 2:240651342-240651364 GTGGTGACACACCTGCAGCACGG - Intergenic
948852482 2:240715222-240715244 CAGTGGACCAAGATGCAGCAAGG - Exonic
1169014346 20:2279613-2279635 CTGGGCCTACAGCTGCAGCATGG - Intergenic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1169321205 20:4634655-4634677 CTGTGGACAGGGCCGCAGCAGGG - Intergenic
1170613819 20:17933892-17933914 CTGTGTGCATAGCTGCAGCCAGG + Intergenic
1171455558 20:25270025-25270047 CTGGGGACTCGCCTGCAGCAGGG - Intronic
1171727206 20:28635479-28635501 CTGTGGACTCAGATTCAGCCAGG - Intergenic
1171750496 20:29044346-29044368 CTGTGGACAGCGACGCAGCAGGG + Intergenic
1171791925 20:29534792-29534814 CTGTGGACTCAGATTCAGCCAGG - Intergenic
1171856416 20:30348092-30348114 CTGTGGACTCAGATTCAGCCAGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172898372 20:38316411-38316433 CTGGGGACCCAGCTGCCTCAAGG - Intronic
1173163477 20:40669878-40669900 CTGTGGACACAGGCCCAGGAGGG + Intergenic
1173786799 20:45799758-45799780 CTGTGGACACAGCAGTAACTAGG - Intronic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1174323753 20:49762664-49762686 CTGTAGGCAGAGCAGCAGCATGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1175820712 20:61907367-61907389 GTGTGGCCACAGCCTCAGCAAGG + Intronic
1175895838 20:62335251-62335273 CTGAGGTCGCAGCTGCAGCCTGG + Exonic
1175908352 20:62392825-62392847 CTGTGGGCAAAGCTGCCCCAGGG - Intronic
1175934145 20:62507418-62507440 CTGTGGGCACAGCCCCATCATGG + Intergenic
1176313725 21:5221792-5221814 CTGTGGACTCAGATTCAGCCAGG - Intergenic
1176314668 21:5231380-5231402 CTGTGGACAGCCCCGCAGCAGGG - Intergenic
1176314685 21:5231443-5231465 CTGTGGACAGCCCCGCAGCAGGG - Intergenic
1176989507 21:15478225-15478247 CAGTTGACACAGCTATAGCATGG - Intergenic
1179064648 21:38013741-38013763 CTCTGCACACAGCTGGGGCATGG - Intronic
1179158974 21:38876334-38876356 CTTTGAACACACCTGCAACAAGG - Intergenic
1179437673 21:41373531-41373553 CTGTGGACAGAGCAGCTGGAGGG - Intronic
1180072575 21:45443671-45443693 CTGGGGACCCGGCTGCAGCCCGG - Intronic
1180100282 21:45580778-45580800 CTGCGGTCACAGCTGCAGGGCGG - Intergenic
1180162644 21:46005247-46005269 CTCTGTCCACAGGTGCAGCATGG - Intergenic
1180391546 22:12287901-12287923 CTGTGGACTCAGATTCAGCCAGG - Intergenic
1180392457 22:12297338-12297360 CTGTGGACAGCCCCGCAGCAGGG - Intergenic
1180407291 22:12567430-12567452 CTGTGGACAGCCCCGCAGCAGGG + Intergenic
1180408199 22:12576853-12576875 CTGTGGACTCAGATTCAGCCAGG + Intergenic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1180965086 22:19783996-19784018 AGGTGGGCACAGCTGCTGCACGG - Exonic
1181529985 22:23511888-23511910 CTGTGGACAGGGCTGCAGATGGG + Intergenic
1181749003 22:24976132-24976154 CAGTGTTCCCAGCTGCAGCAGGG - Intronic
1181757612 22:25035667-25035689 CTGTAGTGACAGCAGCAGCAAGG + Intronic
1182711782 22:32327796-32327818 CCACGGACACAGATGCAGCAAGG + Intergenic
1183050974 22:35260903-35260925 CTGTGGACAATACTGAAGCATGG - Intronic
1183655954 22:39184839-39184861 CTGTGCCCACTCCTGCAGCAAGG + Intergenic
1183698484 22:39436710-39436732 CAGTGGACACAGATGCATGAGGG - Intronic
1185030593 22:48440985-48441007 GTGAGGAGACAGCTGCAGGATGG - Intergenic
1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG + Intergenic
1185228828 22:49668534-49668556 ATGAGGCCACAGCAGCAGCAAGG + Intergenic
949706343 3:6822079-6822101 CTGAGGCCACATCTGCACCAGGG - Intronic
954070835 3:48141718-48141740 CTGTGGGGACAGCTGCTTCATGG + Intergenic
954108956 3:48423762-48423784 ACGTGGCCACAGCTGCAGCCTGG + Exonic
954149887 3:48652049-48652071 CTGTGGACACACAGCCAGCAAGG + Intronic
954303862 3:49715345-49715367 GGCTGGACACAGCTGCAGCCTGG + Intronic
954612483 3:51953200-51953222 CCATGGACAGATCTGCAGCAAGG + Intergenic
954655766 3:52193256-52193278 CAGTGGACTCATCTGCAGCCGGG - Intergenic
955830080 3:62992079-62992101 CTGTGAGCACATCAGCAGCAAGG + Intergenic
956579005 3:70789331-70789353 GTGTGGACACAACAGCAGAATGG - Intergenic
958037581 3:88188666-88188688 CTGTGGTGATGGCTGCAGCAAGG + Intergenic
958573971 3:95923585-95923607 CTGTAGACAGAACAGCAGCATGG + Intergenic
959859360 3:111199349-111199371 CTGTAAACACAGCTACAGAATGG - Intronic
960399515 3:117179246-117179268 CTGTTTCCACAGCTGCAGAATGG + Intergenic
960696930 3:120405629-120405651 CTGTGCACACATCTGCAGTGGGG - Intronic
961357112 3:126346189-126346211 CTGTGTGCCCAGCTGCAGCTGGG - Intronic
961381187 3:126497535-126497557 ATGTGGAGACAGCTTCATCATGG + Intronic
961475889 3:127146066-127146088 CTGTGGAGAAAACTGAAGCAGGG - Intergenic
961677937 3:128578938-128578960 CAGTGGGGACAGCTGCAGGATGG + Intergenic
961774514 3:129274740-129274762 CTGTGGAAAGAGTTGCAGGAAGG + Intronic
964936877 3:162100273-162100295 CTGTGGGCACCCCAGCAGCAAGG + Intergenic
965045688 3:163573792-163573814 CTCTGGACCCAGCTGCAACCAGG + Intergenic
966822864 3:183938801-183938823 CTGTTGCCACAGCAGCAGCTGGG + Intronic
968083101 3:195860412-195860434 CTGTGGACCCATCTGGGGCACGG + Intergenic
968575821 4:1365698-1365720 CTGTGGTCACACCAGCACCACGG + Intronic
969136472 4:5033253-5033275 CGGCGTCCACAGCTGCAGCACGG + Intergenic
969543279 4:7807423-7807445 CAGAGGAAACAGCTGTAGCACGG - Intronic
969656017 4:8499016-8499038 CTGTGGCTCCAGGTGCAGCAGGG + Intergenic
971176060 4:24283781-24283803 GTGTGTACAGAGCTGAAGCAAGG - Intergenic
972180563 4:36459657-36459679 CTGTAAACACAGCAGCAGCCAGG + Intergenic
972344047 4:38177804-38177826 CTCAGAACACAGCTGCGGCATGG + Intergenic
975651572 4:76598645-76598667 AGGTGGATACAGCTGCACCAGGG - Intronic
976206105 4:82624919-82624941 ATGTGCACACAGCTGCACCATGG - Intergenic
976412883 4:84737230-84737252 ACGTGGACATAGCTACAGCAAGG - Exonic
978964704 4:114726107-114726129 CAGTGGTACCAGCTGCAGCAGGG - Intergenic
982957600 4:161792019-161792041 CTGGGTCCACAGCTGCAGCTGGG - Intronic
984878614 4:184391031-184391053 TTGTGGACAGAGCTGCAGTGAGG - Intronic
985360609 4:189171739-189171761 CTGAAGAAACAGCTCCAGCATGG - Intergenic
985402767 4:189608027-189608049 GTGTGGAGTCAGGTGCAGCAGGG - Intergenic
985524265 5:394186-394208 CTGAGCACAAAGCTGCAGCCTGG - Intronic
986573295 5:9187842-9187864 CTCAGGACTCAGCTGCCGCAGGG - Intronic
990320909 5:54628809-54628831 CTAAGGCCAAAGCTGCAGCACGG - Intergenic
992748784 5:79843230-79843252 CTGGGGACCCAGCAGCAGCAAGG + Intergenic
993711896 5:91233484-91233506 GTGTGCACACATCTGCAGAAAGG + Intergenic
993736119 5:91478287-91478309 CTGTGGACATAGCAGTTGCAAGG + Intergenic
996744890 5:126839292-126839314 TTGTGAACACATCTCCAGCAAGG + Intergenic
997522476 5:134532005-134532027 CTGTGGTCCCAGCTGCTGAAGGG - Intronic
997786083 5:136715279-136715301 CTGTGAAAACAGCTGCACCTGGG - Intergenic
998191658 5:140030477-140030499 CTGTGGGCATAGGTGAAGCAGGG + Intronic
999454483 5:151703334-151703356 CTCTAGGGACAGCTGCAGCAAGG - Intergenic
999657428 5:153824587-153824609 CTGAAGAGAGAGCTGCAGCAAGG + Intergenic
1001008192 5:168073619-168073641 CTGTGTACACAACTCCAGCTAGG + Intronic
1001020487 5:168178451-168178473 GTGGGGAGACAGCTGCAGCCAGG + Intronic
1001316133 5:170642360-170642382 CTGTGCACACAGTGCCAGCAAGG + Intronic
1004349403 6:14878112-14878134 CTGTGGACACAGTGGCTACATGG - Intergenic
1004421621 6:15475583-15475605 CTGAGGTCGCAGGTGCAGCACGG - Intronic
1005984743 6:30864365-30864387 CTGAGCACACAGCTTCAGGAGGG - Intergenic
1006339986 6:33441585-33441607 CAGTGGACCCAGCTTCAGGAGGG - Exonic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006507890 6:34502148-34502170 CTGTGGAAAACGCTGCACCAGGG - Intronic
1007738264 6:43995286-43995308 CTGAGGACACCAGTGCAGCAGGG + Intergenic
1007774568 6:44217737-44217759 TTGTGGATACAGCTGCTGCCAGG - Intergenic
1007925661 6:45647531-45647553 TTAGGGACACAGCTGCAGCCAGG + Intronic
1010391436 6:75342780-75342802 CTGTGGAAATAGCTGAGGCAGGG - Intronic
1010597844 6:77787148-77787170 CTGTGGACACTGAAGCAGCCAGG + Intronic
1010712260 6:79188990-79189012 TTGTGGAATCAGCTGCAGGATGG + Intergenic
1013111703 6:107069769-107069791 CTGGGCACACTGCTGCAGCCAGG + Exonic
1016256242 6:142109113-142109135 CTATGAAAACAGCTGAAGCAGGG - Intergenic
1017712495 6:157182983-157183005 CTGTGGACACAGTCACAGTAAGG - Intronic
1017764767 6:157597629-157597651 CTCTGGAGGCAGCTGCAGCCTGG + Intronic
1018409552 6:163529872-163529894 TTGTGGACAGATTTGCAGCAGGG + Intronic
1018689773 6:166335281-166335303 CGGTGGATACAGTGGCAGCAGGG + Intronic
1018713383 6:166513633-166513655 CACTGGACACAGGGGCAGCATGG + Intronic
1019214972 6:170437695-170437717 CTCTGGACAGAGCTGCACCCAGG + Intergenic
1019315496 7:382436-382458 CTGAGGACACAGCAGTAGAATGG + Intergenic
1019612241 7:1942372-1942394 CTGTGGTCACAGCAGCAGGCTGG - Intronic
1019694414 7:2437172-2437194 GTGTGGACACAGCTGGAGGATGG - Intergenic
1019885364 7:3899728-3899750 CTGGGGAGAGAGATGCAGCATGG - Intronic
1020812529 7:12864414-12864436 CTGAGTTCACAGCTGCAGAAGGG + Intergenic
1023659694 7:42459366-42459388 CTGGGGCCAGAGCTGCTGCATGG - Intergenic
1023923098 7:44645259-44645281 CTGTGGCCACAGATGCATCCTGG + Intronic
1024448388 7:49509441-49509463 CTATGGAAACAGCTGTTGCAGGG - Intergenic
1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG + Intronic
1026908919 7:74081444-74081466 CTGTGGGCACAGCATCAACATGG + Intergenic
1027994770 7:85411731-85411753 CATTGGCTACAGCTGCAGCAGGG + Intergenic
1028264390 7:88705239-88705261 CTCTGGACCCAGCTGGAGCCTGG - Intergenic
1028381036 7:90198653-90198675 CTGTGGACACAGCTCCTGTCTGG + Intronic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1030675955 7:112385324-112385346 CTATCGACACAGTTGCAGGAAGG + Intergenic
1031230998 7:119106144-119106166 CTGAGAACAAAGCTGCAGCTGGG + Intergenic
1032665752 7:134034586-134034608 CTGTTCACAAAGCTGCAGGAAGG - Intronic
1032793824 7:135261701-135261723 CTGTGGGCACAGAAGCAGTAGGG + Intergenic
1032978635 7:137254875-137254897 CTGTGGATACTGCTGAAGCAGGG - Exonic
1033530365 7:142256870-142256892 CAGAGGCAACAGCTGCAGCATGG + Intronic
1033553128 7:142465516-142465538 CTGAGGCCAGAGCTGCAGGAGGG - Intergenic
1033555465 7:142484964-142484986 CTGAGGCCAGAGCTGCAGGAGGG - Intergenic
1033560079 7:142522499-142522521 CTGAGGTCAGAGCTGCAGGAGGG - Intergenic
1035353837 7:158265426-158265448 CTGTGGGCACACCTGCAGGCAGG + Intronic
1035460116 7:159033352-159033374 CTGTGCACAGAGCTGTACCATGG - Intronic
1036598209 8:10233186-10233208 TTGTAGCCACTGCTGCAGCAGGG + Intronic
1036644352 8:10602441-10602463 CTGTGGACACGGGGGCAGGAGGG + Intergenic
1036766624 8:11553648-11553670 CTGGGGGCACAGCTGCACCCGGG + Intronic
1036835402 8:12060528-12060550 CTGTGAGCAGGGCTGCAGCAGGG + Intergenic
1036857244 8:12307098-12307120 CTGTGGACCCTGCTGCAGCCCGG - Intergenic
1039600038 8:38828737-38828759 TTGAGGACACAGCAGAAGCAGGG - Intronic
1039615958 8:38955152-38955174 CCGTGGACACTGCTGCAGATGGG - Intronic
1040765284 8:50902398-50902420 CTGGGGATACAGGTGCAGTATGG - Intergenic
1041097777 8:54366453-54366475 GTGTGGCCACACCTGCACCAAGG + Intergenic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1042859649 8:73299285-73299307 CTGGGGACCCAGCCACAGCAAGG - Intronic
1043033754 8:75171003-75171025 ATGTGGACACAGCTACAAGATGG + Intergenic
1044791511 8:95852316-95852338 CTGAGCACCCATCTGCAGCATGG + Intergenic
1044917665 8:97132783-97132805 ATGTGGACAGAGCTGCAGAAAGG + Intronic
1045355279 8:101382492-101382514 CAGTTGACAAAGCAGCAGCAGGG - Intergenic
1046285768 8:112091826-112091848 CTCAGGCAACAGCTGCAGCAAGG + Intergenic
1046458247 8:114497736-114497758 TTGTGGGCACAGGAGCAGCATGG + Intergenic
1048239731 8:132729656-132729678 CTGTGGACAAAGCTGCCAAAAGG + Intronic
1049017941 8:139934658-139934680 CTGTGGCCACATGTGCAGCCTGG - Intronic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049130198 8:140832680-140832702 CTGTGGACAAAGAGGCAACAGGG + Intronic
1049435818 8:142585756-142585778 CTGTGGAGACGGGTGCAGGAGGG - Intergenic
1049528880 8:143143355-143143377 CTCTGGGCACCGCTGCAGGACGG - Intergenic
1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG + Exonic
1049939621 9:532899-532921 TTGTGTACACAGCTGCAGGAGGG + Intronic
1050932416 9:11347449-11347471 CCTTAGACACAGCAGCAGCATGG + Intergenic
1051161748 9:14216445-14216467 CTGTGGATACAGATGCACCTTGG - Intronic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1053619240 9:39798993-39799015 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1053721574 9:40952011-40952033 CTGTGGACAGCCCCGCAGCAGGG + Intergenic
1053721582 9:40952043-40952065 CTGTGGACAGCCCCGCAGCAGGG + Intergenic
1053721598 9:40952106-40952128 CTGTGGACAGCCCCGCAGCAGGG + Intergenic
1053721614 9:40952168-40952190 CTGTGGACAGCCCTGCAGCAGGG + Intergenic
1053721622 9:40952199-40952221 CTGTGGACAGCTCCGCAGCAGGG + Intergenic
1053722542 9:40961623-40961645 CTGTGGACTCAGATTCAGCCAGG + Intergenic
1053877396 9:42558342-42558364 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1054234299 9:62543380-62543402 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054264917 9:62908436-62908458 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054344326 9:63899731-63899753 CTGTGGACAGCCCCGCAGCAGGG - Intergenic
1054344339 9:63899794-63899816 CTGTGGACAGCTCCGCAGCAGGG - Intergenic
1054344347 9:63899825-63899847 CTGTGAACAGCCCTGCAGCAGGG - Intergenic
1054344384 9:63899982-63900004 CTGTGGACAGCCCCGCAGCAGGG - Intergenic
1054344406 9:63900077-63900099 CTGTGGACAGCCCCGCAGCAGGG - Intergenic
1054344413 9:63900109-63900131 CTGTGGACAGCCCCGCAGCAGGG - Intergenic
1054344420 9:63900141-63900163 CTGTGGACAGCCCCGCAGCAGGG - Intergenic
1057080714 9:92172599-92172621 CTGGGCACACTGCTGCAGCCAGG - Intergenic
1057443863 9:95100018-95100040 CTGTGGACATGGTGGCAGCAGGG - Exonic
1057518119 9:95738532-95738554 CTGCAGACCCAGCTGCAGCGAGG - Intergenic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060802496 9:126553652-126553674 CAGTGGACACAGCCACTGCAAGG - Intergenic
1061041382 9:128142753-128142775 CTGTGTAGACAGCTGCAGCTGGG - Intergenic
1061215606 9:129220072-129220094 CTGCGGACACATCTGAATCAGGG - Intergenic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061250384 9:129422991-129423013 CTGTGGACAGGGCTGCAGGCGGG - Intergenic
1061816341 9:133199699-133199721 CTGGGAACGCAGCTGCAGCTGGG - Intergenic
1062245861 9:135565714-135565736 CTGGGGACACAGCAGCCCCAGGG - Intronic
1062429080 9:136519015-136519037 CTGTGGACACTGCTGCGTCGGGG + Intronic
1062580882 9:137228741-137228763 CTGTGGACACACCTTCTGCCAGG + Exonic
1062624184 9:137435536-137435558 CTGTGGCCACGGCCGCAGCTGGG - Intronic
1062686457 9:137815924-137815946 CTGTGGACAGATGAGCAGCAAGG - Intronic
1203453519 Un_GL000219v1:143734-143756 CTGTGGACAGCCCCGCAGCAGGG - Intergenic
1203453571 Un_GL000219v1:143954-143976 CTGTGGACAGCCCCGCAGCAGGG - Intergenic
1203453580 Un_GL000219v1:143985-144007 CTGTGGACAGCCCCGCAGCAGGG - Intergenic
1203453596 Un_GL000219v1:144048-144070 CTGTGGACAGCCCCGCAGCAGGG - Intergenic
1186785822 X:12955206-12955228 CAGAGGACCCAGCTGGAGCAGGG + Intergenic
1188734044 X:33690367-33690389 CTGTGGAAACTGTTGAAGCATGG - Intergenic
1191783704 X:64895018-64895040 CTGGGCACACAGGTGCAGTAAGG + Intergenic
1195625064 X:106999334-106999356 CTGCGGACCCAGCTGCCTCAGGG + Intronic
1197723130 X:129758482-129758504 CTGTGGCAACTGCTGCAGCTGGG + Intronic
1198515137 X:137399831-137399853 CTCTGGACACACCTGGGGCATGG - Intergenic
1199404928 X:147445525-147445547 CTGTAGACAGAGCAGCAGCATGG - Intergenic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1200283581 X:154799839-154799861 CAGAGGAAACATCTGCAGCAGGG + Intronic
1200833794 Y:7713046-7713068 CTGTGGAAACAGCTTCAAGATGG + Intergenic