ID: 1169211677

View in Genome Browser
Species Human (GRCh38)
Location 20:3769165-3769187
Sequence CAGAAAGAGGCGGAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169211677_1169211685 0 Left 1169211677 20:3769165-3769187 CCTGCCTCCTCCGCCTCTTTCTG No data
Right 1169211685 20:3769188-3769210 GAATCAGGAATCTGGTTTCGTGG No data
1169211677_1169211684 -8 Left 1169211677 20:3769165-3769187 CCTGCCTCCTCCGCCTCTTTCTG No data
Right 1169211684 20:3769180-3769202 TCTTTCTGGAATCAGGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169211677 Original CRISPR CAGAAAGAGGCGGAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr