ID: 1169214751

View in Genome Browser
Species Human (GRCh38)
Location 20:3786543-3786565
Sequence GGTGCCCCCCGCCACGGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169214751_1169214764 23 Left 1169214751 20:3786543-3786565 CCGGGCCCGTGGCGGGGGGCACC 0: 1
1: 0
2: 1
3: 25
4: 216
Right 1169214764 20:3786589-3786611 GCCCGAGACAAAGCGGCTCGCGG 0: 1
1: 0
2: 0
3: 3
4: 65
1169214751_1169214766 24 Left 1169214751 20:3786543-3786565 CCGGGCCCGTGGCGGGGGGCACC 0: 1
1: 0
2: 1
3: 25
4: 216
Right 1169214766 20:3786590-3786612 CCCGAGACAAAGCGGCTCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 44
1169214751_1169214768 29 Left 1169214751 20:3786543-3786565 CCGGGCCCGTGGCGGGGGGCACC 0: 1
1: 0
2: 1
3: 25
4: 216
Right 1169214768 20:3786595-3786617 GACAAAGCGGCTCGCGGGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 60
1169214751_1169214760 16 Left 1169214751 20:3786543-3786565 CCGGGCCCGTGGCGGGGGGCACC 0: 1
1: 0
2: 1
3: 25
4: 216
Right 1169214760 20:3786582-3786604 GCGCCCCGCCCGAGACAAAGCGG 0: 1
1: 0
2: 0
3: 6
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169214751 Original CRISPR GGTGCCCCCCGCCACGGGCC CGG (reversed) Exonic
900095282 1:937693-937715 GGTGCCCCCCGCCGCCCGCCGGG + Intronic
900096025 1:940429-940451 GGTGGGTCCCGCCCCGGGCCGGG - Intronic
900173251 1:1280886-1280908 GGTGCCCCCGGCTGCTGGCCTGG - Intronic
900245550 1:1634496-1634518 GGTGCGCCTCGCCCAGGGCCAGG - Exonic
900256779 1:1701653-1701675 GGTGCGCCTCGCCCAGGGCCAGG - Intronic
900290923 1:1923297-1923319 GGGGCCCCCATCCACGGGACAGG + Intronic
900302929 1:1986911-1986933 GGTGGCCCTCGCCAGGGGGCAGG - Intronic
900462544 1:2808593-2808615 GGTGTCCCCCGCACCTGGCCCGG - Intergenic
901114591 1:6832226-6832248 GGTGCTCGCCACCACGGACCTGG + Intronic
901332809 1:8423868-8423890 GGGGCCCCGCGCCCCGGCCCCGG + Intronic
902298207 1:15482928-15482950 AGTGCCCACCACCACAGGCCCGG + Intronic
904699837 1:32351665-32351687 GCTGCCCCCGGCCACCGGCCTGG - Intronic
904774030 1:32895840-32895862 GCAGCCACCCGCCAAGGGCCTGG - Intronic
905202328 1:36323203-36323225 GGTTCCCCCCGACAGGGCCCCGG - Intronic
905797581 1:40824209-40824231 GTTGCCACCTGCCACCGGCCGGG + Exonic
906203446 1:43974635-43974657 GGCGCCACCCGCCACAGGCTAGG + Exonic
907118681 1:51990479-51990501 GGTGCCCAGCGCCCCGCGCCGGG + Intronic
907540890 1:55214914-55214936 GGTGGCCCCAGCCCCGGGCCCGG - Exonic
908703938 1:66930438-66930460 GGCGCCCCCGGCCCTGGGCCGGG + Intronic
912831456 1:112956897-112956919 GGCGCCAACCGCCGCGGGCCTGG - Intronic
913163951 1:116168408-116168430 GGAGCACCCCGCCAGGGGACCGG + Intergenic
913451946 1:118998632-118998654 AGTGCCCCCCCCCACTGGCCTGG + Intergenic
915538784 1:156554263-156554285 GGTGAACCCTGCCACAGGCCTGG - Exonic
920037621 1:203076086-203076108 GGTGCCCGCGTCCCCGGGCCTGG - Intronic
920347229 1:205314171-205314193 GGTCACCCCGGCAACGGGCCAGG + Intronic
922752599 1:228077625-228077647 GTTGGCCCCTGCCACTGGCCTGG + Intergenic
922794870 1:228335034-228335056 GGTGCACCCCGCCAGGAGCGGGG - Intronic
923163376 1:231337291-231337313 GGTGCCTCCCGCGACGGCTCCGG - Exonic
924362342 1:243254917-243254939 GGCGCCGCCCGCCGCGGGGCGGG - Intronic
924732491 1:246724544-246724566 GGAGCGGCCCGCCACGGCCCAGG - Exonic
1062823140 10:549621-549643 GGTGCCCCCGACCAGGTGCCGGG + Intronic
1062956572 10:1544220-1544242 GGTGCCACCTGCCCCAGGCCAGG - Intronic
1063380315 10:5580993-5581015 GGTGCCCCCATCCCCCGGCCTGG + Intergenic
1065188730 10:23192421-23192443 GCTGCCCCCAGCCAGGGCCCCGG + Exonic
1066108074 10:32172674-32172696 GGTGCCCGCCACCACGCCCCTGG - Intergenic
1066994561 10:42552165-42552187 GGTGCCTCCCTCCACGTGCGCGG + Intergenic
1068029787 10:51692385-51692407 GGTGCCCACCACCACGCCCCTGG + Intronic
1073217301 10:101843591-101843613 GGCGCCCCCTCCCACGGCCCGGG - Intronic
1077373066 11:2192667-2192689 GGGACCCCCCACCAAGGGCCTGG + Intergenic
1077375804 11:2204632-2204654 GGTGCCCCCTTCCACTGCCCTGG + Intergenic
1078375076 11:10786523-10786545 GGTGCCCCACTCCAGGGCCCAGG + Intergenic
1079616940 11:22506771-22506793 GGCGCCCGCCACCACGCGCCTGG + Intergenic
1080541840 11:33273362-33273384 GGTGCCCGCCACCACACGCCTGG - Intronic
1083306926 11:61766155-61766177 GGTGCCCCCCGGGAAGGGCTTGG - Exonic
1083594959 11:63914816-63914838 GCTGCCCCTTGCCCCGGGCCAGG - Exonic
1084323382 11:68385766-68385788 GGAGCCCCCCGGCACGGTGCTGG + Intronic
1084784714 11:71435524-71435546 GGTGGCCGCCGCCACAGGCCAGG + Exonic
1089634557 11:119803919-119803941 GAAGCCCCCAGCCACGGCCCAGG - Intergenic
1090023863 11:123151070-123151092 GGTGGCTCCTGCCACGTGCCAGG + Intronic
1090194096 11:124800223-124800245 GGTGCCTCCCCGCTCGGGCCGGG - Exonic
1090699042 11:129278825-129278847 GCTGCCGCCCGCCTTGGGCCCGG + Intronic
1091330548 11:134728213-134728235 GGTGACTCCCGCCCTGGGCCTGG + Intergenic
1091589913 12:1836884-1836906 GGTGCCTCCCACCCAGGGCCAGG + Intronic
1091784341 12:3233390-3233412 GGTGCCCTCCGCCAGGGGATGGG - Intronic
1095906283 12:47381617-47381639 GGTGCCCGCCACCATGCGCCTGG + Intergenic
1096468942 12:51864353-51864375 GGCGCCCCCGGCCCGGGGCCCGG + Intergenic
1096838963 12:54369666-54369688 GCTGCCCCCTGCAATGGGCCCGG + Exonic
1100611546 12:96194943-96194965 GGTCCCCGCAGCCCCGGGCCCGG - Intronic
1101771982 12:107760689-107760711 CGTGCACCCCGCCACGGGTTGGG + Exonic
1102150888 12:110688774-110688796 GGTGCGCGCCGCCCTGGGCCAGG - Intronic
1103779410 12:123389149-123389171 GGGGCGCGCCGCCATGGGCCTGG + Intronic
1104008954 12:124915258-124915280 GGAGCCCCCCGCGACCGGCCTGG - Exonic
1104442205 12:128802923-128802945 GGTGCCCCCAGTCACGAGCGAGG + Intronic
1104589781 12:130075022-130075044 GGTGCCTCCCGCCTCGGGGGTGG - Intergenic
1104636072 12:130438454-130438476 GGTGACCCCCGCCACCATCCGGG - Exonic
1104975867 12:132551731-132551753 GGAGCCTCCTGCCAAGGGCCAGG - Intronic
1105403852 13:20118350-20118372 GAGGCTCCCCGCCAGGGGCCTGG - Intergenic
1112186577 13:97133618-97133640 GGTGCCCCCCACCCAGGGTCTGG - Intergenic
1112507746 13:99985236-99985258 GGTGCTCTCCCCCAGGGGCCCGG + Intronic
1113811855 13:113147515-113147537 GGTGCCCCTCACCACGGCCCTGG - Intronic
1117899275 14:60515677-60515699 GCTGCCGCCCGCGTCGGGCCTGG + Intergenic
1119290486 14:73491419-73491441 GGTGCCCGCCGCGCCGGTCCGGG + Exonic
1121342685 14:93114998-93115020 GGTGACCCCCGGCCCGAGCCCGG - Intronic
1122816281 14:104315790-104315812 GGTGGCCCCTGCCATGGGCATGG - Intergenic
1123036816 14:105474994-105475016 GGTGCGCCCGGCCCCGGCCCCGG + Intronic
1127225148 15:56919555-56919577 GGTGCTCCGCGCGCCGGGCCCGG - Intronic
1131097479 15:89665741-89665763 CGCGCCCCCCGGCCCGGGCCTGG - Exonic
1132465980 16:77686-77708 GGAGGCCCCCGCCCCTGGCCGGG - Intronic
1132661005 16:1061536-1061558 GGTGCCCACCCCCACCTGCCAGG - Intergenic
1132715032 16:1285923-1285945 CGTCCCCCCCTCCACGGCCCAGG - Intergenic
1132723964 16:1330871-1330893 TCCGCCCCCCGCCACCGGCCCGG + Intergenic
1132814518 16:1819353-1819375 GGTGCTCCCCACCACGGGACTGG + Intronic
1132838846 16:1968472-1968494 GGTGCCCCTTGCGATGGGCCAGG - Exonic
1132849856 16:2020110-2020132 GGTGTCCCTGGCCAGGGGCCCGG - Exonic
1132942057 16:2513378-2513400 GGTGACCGCAGCCACGGGCTGGG + Intronic
1133440935 16:5820417-5820439 GGTGACCCCGGCCACGTGGCTGG + Intergenic
1136355820 16:29744453-29744475 GAGGCCCCCCGCCACAGGCCTGG - Exonic
1137555764 16:49469351-49469373 TGTGCCCCCCAGCACGGGCTTGG + Intergenic
1137665029 16:50245060-50245082 GTTGCCCCCCGCGGTGGGCCTGG - Intergenic
1139215565 16:65122316-65122338 GGAGCGCCGCGCCACGGGGCGGG - Intronic
1139956982 16:70697840-70697862 GATGCCCCCAGACATGGGCCTGG + Intronic
1141209657 16:81965496-81965518 GGTGCGCGCCACCACGTGCCTGG - Intergenic
1142611038 17:1109312-1109334 GTTCGCCTCCGCCACGGGCCGGG - Intronic
1142664799 17:1456375-1456397 GGTGCCGCCCTTCCCGGGCCCGG + Intronic
1144217267 17:13067621-13067643 GGTGCCCCCCGCTGCAAGCCTGG - Intergenic
1145062011 17:19739468-19739490 GGTGCCCTCTGCCAGGGTCCTGG - Intronic
1146460947 17:33045631-33045653 GGTGGCCCCCGCCATGACCCTGG - Intronic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1150388944 17:64780088-64780110 GGTGACCCAGGCCAAGGGCCAGG + Intergenic
1150464107 17:65377207-65377229 GGTGCCCCCCGCCAAGTGGCAGG - Intergenic
1151347581 17:73511587-73511609 GGAGCCCCCAGCCCAGGGCCTGG - Intronic
1151384420 17:73746474-73746496 GGTGCCCCCTGCCCTGGGCATGG - Intergenic
1152623785 17:81379284-81379306 TCTGCCCCCTGCCCCGGGCCTGG - Intergenic
1152686269 17:81695230-81695252 TGTGGCTCCCTCCACGGGCCAGG + Intronic
1152772631 17:82179609-82179631 GGTGGACCCAGCCACGGGGCGGG + Intronic
1152808855 17:82371807-82371829 CGCGCCCCCCGCCCCGCGCCGGG - Intergenic
1157464529 18:47931577-47931599 GGCGCGCCCAGTCACGGGCCGGG - Intergenic
1159025892 18:63181962-63181984 GGTGCCCCCCAGCAGGTGCCTGG - Intronic
1159342644 18:67155891-67155913 TGTGCCCCCAGCCCTGGGCCCGG - Intergenic
1160265191 18:77335961-77335983 GGTGCCACACCCCAGGGGCCTGG - Intergenic
1161068804 19:2250506-2250528 CATGCCCCCCGCCACGGCCCGGG - Intronic
1161101868 19:2425493-2425515 GGTGAGCCCCGCCCCGGCCCAGG + Exonic
1161267326 19:3370276-3370298 TGTGCCCCCCACCCGGGGCCTGG + Intronic
1161304120 19:3557491-3557513 GGGGACCCCCACCACGCGCCGGG + Exonic
1161381305 19:3966497-3966519 GGTGGCCCCTGCCGCGAGCCTGG - Intronic
1161477316 19:4493893-4493915 GGAGCGCCCCGGCAGGGGCCAGG - Intronic
1162027869 19:7904460-7904482 GGCGCCCCCCTCCCCCGGCCTGG + Intronic
1162312147 19:9913914-9913936 GGCGCCCCCCGCCCCCCGCCGGG - Intronic
1163248600 19:16112191-16112213 GGTCTCCCCCACCACGGCCCAGG - Intronic
1163437893 19:17306165-17306187 GGTGGCTCCAGCCCCGGGCCTGG + Exonic
1163651905 19:18522579-18522601 GGTAGGCCCCGCCGCGGGCCGGG + Intergenic
1163720601 19:18896432-18896454 CGTGCCCCCCGTCACGGGCACGG - Intronic
1165065473 19:33225837-33225859 GGGGCCCCCAGTCCCGGGCCCGG - Exonic
1165089298 19:33374169-33374191 GGCGCCCCTCGCGGCGGGCCGGG + Intronic
1165092009 19:33392537-33392559 GGGGCCCCCCGCCACGTGCCTGG - Intronic
1165138256 19:33684336-33684358 CGTGCCGCCCGGCAGGGGCCTGG + Intronic
1167314138 19:48754039-48754061 GGCGCCCTCCACCACGCGCCCGG - Intronic
1167491696 19:49796215-49796237 GGTGCCCCCTGCCCAGTGCCTGG - Intronic
1167622628 19:50567979-50568001 GGGTCCTCCCCCCACGGGCCGGG - Intronic
1168152052 19:54454588-54454610 GGCGGGGCCCGCCACGGGCCAGG + Exonic
1168297305 19:55383741-55383763 CGCGCCCGCCGCCCCGGGCCCGG + Exonic
1168312451 19:55467753-55467775 GGGGCCCGCCGCCACGTGGCTGG + Intergenic
925414207 2:3657973-3657995 GCTGCCTCCGGCCACTGGCCTGG - Intergenic
927200914 2:20577579-20577601 GGTGCCCCTCACCTTGGGCCTGG - Intronic
929144934 2:38698351-38698373 GGTGCCACCTGCCATGGGACAGG - Intronic
929218070 2:39436999-39437021 GGTGCCCCCCGCCTCCCTCCCGG + Exonic
929552527 2:42903622-42903644 GCTGCCCCCTGCCACTGCCCTGG + Intergenic
932479829 2:72032552-72032574 GGGGCCCCCACCCAGGGGCCTGG + Intergenic
932599385 2:73113137-73113159 GGCGCCCCCAGCCAGGGGCGGGG - Intronic
933786793 2:85849468-85849490 GGTGCCCACCACCACGTGCCCGG - Intronic
933986523 2:87596340-87596362 GGTGTCCCCCTCCACGTGCCTGG + Intergenic
935746485 2:106194020-106194042 GTTGCTCCCCGCCCCGGGCGGGG - Intronic
936307315 2:111354461-111354483 GGTGTCCCCCTCCACGTGCCTGG - Intergenic
937984199 2:127631245-127631267 GGTGGCCACGGGCACGGGCCAGG - Exonic
945910494 2:215643629-215643651 GGTGCCCACCACCACATGCCCGG + Intergenic
947534396 2:230931795-230931817 GGTGCCCCACTCCACTGCCCGGG + Intronic
948353508 2:237359783-237359805 GGTGCCCACGGCCCCGGCCCTGG - Intronic
948421714 2:237864146-237864168 GCTGGCCCAGGCCACGGGCCAGG - Intronic
948468677 2:238164087-238164109 GGTGCCTTCCGCCGCGGCCCGGG + Exonic
948599843 2:239101831-239101853 GGAGCCCCCGGCCCCGGGTCCGG + Intronic
948738268 2:240025236-240025258 GGCGCCCGCCGCCACGACCCGGG + Exonic
1168795982 20:610368-610390 GGAGCCCTCCGCCCCCGGCCGGG - Exonic
1169214751 20:3786543-3786565 GGTGCCCCCCGCCACGGGCCCGG - Exonic
1169808181 20:9580782-9580804 GGAGCCTCCAGCCACGGTCCAGG - Exonic
1171782041 20:29427966-29427988 CATGCCCCCCGCCAGGGGCAGGG - Intergenic
1172006872 20:31823941-31823963 GGTGCCCTCCCCCAGGGCCCAGG + Intronic
1172064180 20:32207648-32207670 GGGGCCCCACGCTGCGGGCCGGG + Exonic
1172261677 20:33572033-33572055 GGCGCCTGCCACCACGGGCCTGG + Intronic
1172596582 20:36154666-36154688 GGTGCCCACAGCCCCGGGCCTGG - Intronic
1175219577 20:57409144-57409166 GCTGCCCCCCGCCCTCGGCCAGG - Exonic
1175859421 20:62142646-62142668 GGAGGCGCCCGCCACCGGCCAGG + Intronic
1175903518 20:62369075-62369097 GCTGTCCCCCGGCACTGGCCAGG + Intergenic
1176116566 20:63434212-63434234 GGTGATACCCGCCAGGGGCCAGG - Intronic
1176288959 21:5034199-5034221 CGGGCTCCCCGCCATGGGCCAGG + Intronic
1179304510 21:40142103-40142125 AGTGCCCCCCTCCATGTGCCTGG + Intronic
1179868275 21:44229405-44229427 CGGGCTCCCCGCCATGGGCCAGG - Intronic
1180087027 21:45512269-45512291 GGCTCCCTCGGCCACGGGCCAGG + Exonic
1182352544 22:29706890-29706912 AGTGCCCCCCGCCAAGGGAGAGG - Intergenic
1183683796 22:39350280-39350302 GATCCCGCCCGCCCCGGGCCCGG - Intronic
1184361854 22:44023896-44023918 GGCTCCCCCTGCCCCGGGCCTGG + Intronic
1184850111 22:47115108-47115130 GGTGCCGCCATCCAGGGGCCAGG - Intronic
1185088017 22:48751080-48751102 GGTTCCCCTCGCTGCGGGCCAGG + Intronic
1185313795 22:50170389-50170411 GGTGCCCCCCGCCGCCGCCCCGG + Intergenic
1185381310 22:50508507-50508529 GGCGCCCACAGCCCCGGGCCCGG - Intronic
950506410 3:13397477-13397499 GGTTCCTCCAGCCACAGGCCAGG - Exonic
952827769 3:37538321-37538343 GGAGCCCCCCTGCACGGGCCTGG - Intronic
966372131 3:179261326-179261348 GGAGCCCCCCCCCGCGGGCCGGG + Intronic
967186677 3:186950069-186950091 TGTGCCCCCTTCCACAGGCCTGG - Intronic
968041387 3:195592090-195592112 GGTGTCTCCCTCCAGGGGCCTGG - Intergenic
968742281 4:2337327-2337349 GCTGCCCTCTGCCCCGGGCCTGG + Intronic
968964850 4:3764717-3764739 GCTGCCCCAGGCCACGGGCATGG + Intergenic
972345448 4:38188822-38188844 GGTGCCCCAGGGCACAGGCCAGG + Intergenic
973293327 4:48490704-48490726 GGTGCCCTCGGCCCCGGGGCCGG - Exonic
976431357 4:84966338-84966360 GGAGCCCCGCGCCGCGGGCCGGG + Exonic
985888636 5:2699374-2699396 GGTGCCGGCCCCCAAGGGCCAGG + Intergenic
986202344 5:5589916-5589938 GGTGGCCACCGTCACTGGCCTGG - Intergenic
988577761 5:32444022-32444044 GCCGCTCCCCGCCGCGGGCCGGG + Intronic
992614531 5:78535682-78535704 GGCGCCCCCAGCCACAGGCTTGG - Intronic
992944149 5:81793504-81793526 GGTGCCCCCCCTCACGACCCAGG + Intergenic
996552377 5:124744287-124744309 GGTGCCCCCCGGAAGGGGCCTGG + Exonic
999386510 5:151157561-151157583 GGTACCCCCCGCCAGGAGCAGGG - Intronic
1002512741 5:179733340-179733362 GCCGCCCGCCGCCACGGCCCCGG + Exonic
1003871171 6:10404459-10404481 GGTTCCCCCGGCCGCGGGGCGGG + Intronic
1016272049 6:142301446-142301468 GGGTCCCCCCGCCACGCTCCCGG - Intergenic
1017282208 6:152637100-152637122 CGTGCCCCGCGCCCCGCGCCCGG + Intronic
1017703330 6:157096708-157096730 GGTGCCCACTGCCACCCGCCTGG + Intronic
1019195647 6:170280974-170280996 GGAGCCCCCCGCCGCGGGCACGG - Intergenic
1019297870 7:288738-288760 TGTGCCCACCCCCACGTGCCAGG + Intergenic
1019513314 7:1429163-1429185 GGAGCCTCCCACCTCGGGCCTGG - Intronic
1020140357 7:5608210-5608232 GATGCCCCCGGCCCCTGGCCTGG - Intergenic
1021500920 7:21330644-21330666 GGGGGCCTCCGCCATGGGCCGGG - Intergenic
1022237245 7:28473849-28473871 GAGGCTCCCTGCCACGGGCCAGG - Intronic
1023725731 7:43141271-43141293 GGTGCCCACCCCCACGGCCCTGG + Intronic
1023806536 7:43876806-43876828 GGTGCTCCGTGCCACAGGCCTGG + Exonic
1023823157 7:43991225-43991247 GGAGCCCCCCTCCCAGGGCCAGG - Intergenic
1023881810 7:44325175-44325197 CGAGCCCCCGGCCCCGGGCCTGG - Intronic
1025210572 7:57017743-57017765 GGTGTCCCCCGACACCGGGCAGG + Intergenic
1025661384 7:63559104-63559126 GGTGTCCCCCGACACCGGGCAGG - Intergenic
1027982981 7:85250279-85250301 GGCGCCCCCCCCCCCCGGCCTGG - Intergenic
1028796345 7:94907916-94907938 GGGGCCGCCCGCCGCGGGCAGGG + Intronic
1029495754 7:100894991-100895013 GGCGCTCCCCGCCCCGAGCCAGG + Intronic
1029524694 7:101087696-101087718 GGTGCCCGTCGGCACAGGCCTGG - Exonic
1029751421 7:102544663-102544685 GGAGCCCCCCTCCCAGGGCCAGG - Intronic
1029769373 7:102643756-102643778 GGAGCCCCCCTCCCAGGGCCAGG - Intronic
1033253202 7:139777836-139777858 CGAGCCCCCCGCGCCGGGCCCGG - Intronic
1034446002 7:151114726-151114748 CGTGCCCCTCGCCATGGGCCTGG + Intronic
1034553198 7:151833965-151833987 CCTGGCCCCCGCCATGGGCCGGG - Intronic
1035388405 7:158489641-158489663 GGTGAGCCCCGCCGCTGGCCTGG - Intronic
1036910782 8:12755444-12755466 GCCGCCCGCCGCCACGGTCCCGG + Exonic
1038008703 8:23457298-23457320 GGTGTCCCCTGCCAGGGGCTGGG + Intronic
1038612420 8:29068905-29068927 AGTGCCTCCCCCCAGGGGCCGGG + Exonic
1039800018 8:40946198-40946220 GGTGCACCCCCACACAGGCCAGG + Intergenic
1040834649 8:51719024-51719046 GGTGCCCCCCGCCTCCCTCCCGG - Intronic
1046503426 8:115108132-115108154 GGTGCCCGCCACCACGTGCTCGG - Intergenic
1046871401 8:119208753-119208775 GGTGCCCCGCGCCGCCGCCCGGG + Intronic
1049412200 8:142478373-142478395 GGTGCCCCCCGACCCCAGCCTGG - Intronic
1049463348 8:142740056-142740078 GGCGACCCCCGCCACTGCCCTGG + Intergenic
1049641985 8:143719958-143719980 GGCGCCCACCTCCACGGCCCAGG - Intronic
1049689858 8:143953689-143953711 CGCGCCCCCCGGCTCGGGCCCGG + Intronic
1049755638 8:144310229-144310251 CGTCCCACCCGCCTCGGGCCTGG + Intronic
1051370466 9:16355044-16355066 GGAGCCCTCTGCCACGGGCTGGG + Intergenic
1052991731 9:34522748-34522770 AGGGCCTCCCGCCACGGGCACGG - Intronic
1056536382 9:87531296-87531318 GGTGCCACCAGCCTCAGGCCTGG + Intronic
1057554215 9:96074613-96074635 GGCACCCACCACCACGGGCCTGG + Intergenic
1059021230 9:110579177-110579199 GGTGCCCACGGCCACGCGCGTGG - Exonic
1059650358 9:116310449-116310471 GGTGCCCCACACCATGGGACAGG - Intronic
1062397631 9:136358813-136358835 GGTGCCCCCCGCCGAGTCCCAGG + Exonic
1185610829 X:1392810-1392832 GGTGCCCTCCGCGCCGGGGCTGG + Intergenic
1189538116 X:41957430-41957452 GGTGTCCCCAGCCCCGGGCTGGG - Intergenic
1190108391 X:47574364-47574386 GGGGCCTCCCGCCACTGGCCGGG + Exonic
1191907402 X:66108095-66108117 GGGACCCCCCACCCCGGGCCAGG + Intergenic
1200042436 X:153379838-153379860 AGTGCCCACCTCCAAGGGCCGGG + Intergenic
1200243259 X:154508584-154508606 CCTGCCCAGCGCCACGGGCCAGG - Exonic