ID: 1169214878

View in Genome Browser
Species Human (GRCh38)
Location 20:3786930-3786952
Sequence CGACCCGGCAGCGACGCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169214867_1169214878 9 Left 1169214867 20:3786898-3786920 CCTGCTGGACCTGCCCGTGCTGC 0: 1
1: 0
2: 2
3: 29
4: 264
Right 1169214878 20:3786930-3786952 CGACCCGGCAGCGACGCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 69
1169214869_1169214878 0 Left 1169214869 20:3786907-3786929 CCTGCCCGTGCTGCGGCCTCCGG 0: 1
1: 0
2: 3
3: 11
4: 263
Right 1169214878 20:3786930-3786952 CGACCCGGCAGCGACGCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 69
1169214872_1169214878 -5 Left 1169214872 20:3786912-3786934 CCGTGCTGCGGCCTCCGGCGACC 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1169214878 20:3786930-3786952 CGACCCGGCAGCGACGCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 69
1169214871_1169214878 -4 Left 1169214871 20:3786911-3786933 CCCGTGCTGCGGCCTCCGGCGAC 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1169214878 20:3786930-3786952 CGACCCGGCAGCGACGCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 69
1169214865_1169214878 28 Left 1169214865 20:3786879-3786901 CCGCGGGGGGGCGCTGCGGCCTG 0: 1
1: 0
2: 3
3: 18
4: 217
Right 1169214878 20:3786930-3786952 CGACCCGGCAGCGACGCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169214878 Original CRISPR CGACCCGGCAGCGACGCGGG CGG Intronic