ID: 1169220687

View in Genome Browser
Species Human (GRCh38)
Location 20:3820647-3820669
Sequence GCTGCAGGGGCAACACATTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169220678_1169220687 22 Left 1169220678 20:3820602-3820624 CCCGGACGGAAGGCTGAGGCGAC 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1169220687 20:3820647-3820669 GCTGCAGGGGCAACACATTCAGG 0: 1
1: 0
2: 1
3: 7
4: 171
1169220676_1169220687 29 Left 1169220676 20:3820595-3820617 CCGCGGGCCCGGACGGAAGGCTG 0: 1
1: 0
2: 1
3: 6
4: 99
Right 1169220687 20:3820647-3820669 GCTGCAGGGGCAACACATTCAGG 0: 1
1: 0
2: 1
3: 7
4: 171
1169220682_1169220687 -2 Left 1169220682 20:3820626-3820648 CCTCGACGACAGCGGACCGGAGC 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1169220687 20:3820647-3820669 GCTGCAGGGGCAACACATTCAGG 0: 1
1: 0
2: 1
3: 7
4: 171
1169220679_1169220687 21 Left 1169220679 20:3820603-3820625 CCGGACGGAAGGCTGAGGCGACG 0: 1
1: 0
2: 1
3: 4
4: 50
Right 1169220687 20:3820647-3820669 GCTGCAGGGGCAACACATTCAGG 0: 1
1: 0
2: 1
3: 7
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169220687 Original CRISPR GCTGCAGGGGCAACACATTC AGG Exonic
901434479 1:9238300-9238322 TCTGCAGAGTCTACACATTCTGG - Intronic
908888727 1:68818542-68818564 CCTGCAGTGGCAACCCAGTCGGG + Intergenic
909747242 1:79112936-79112958 CCAGCAGTGGCAACCCATTCAGG + Intergenic
909755524 1:79220861-79220883 GCTGCAGGCTCAACACAATTTGG - Intergenic
913534145 1:119755345-119755367 GCTGCAGGGTCAACAAAGTTGGG - Intronic
915057766 1:153151266-153151288 GCTGCAGGATCAGCACATACTGG - Intergenic
915683577 1:157606758-157606780 GCTGCAGTGGTCACACAGTCAGG + Intergenic
916675160 1:167059316-167059338 GCTGCAGTGGCGACACCTTGTGG + Intronic
917534551 1:175864758-175864780 TCTGCAGGGGCAACCAATTCTGG - Intergenic
917840805 1:178975912-178975934 CCAGCAGTGGCAACACACTCAGG + Intergenic
919519699 1:198572615-198572637 GCTGCAGTTGCAACACAGACTGG + Intergenic
920092097 1:203462141-203462163 GCAGCAGGAGCAAAGCATTCTGG - Intergenic
920544974 1:206808869-206808891 GCTGCAGGGGCTAGAGATGCTGG + Intronic
921670584 1:217919870-217919892 GCTGCCTGTGCTACACATTCTGG + Intergenic
1063541058 10:6934315-6934337 CCAGCAGGGGCAACACACTCAGG - Intergenic
1064868227 10:19906434-19906456 GAGGCAGGGGAAACAGATTCTGG + Intronic
1067799805 10:49351194-49351216 GCTGCAGGGGCAAGGCAGGCTGG - Intergenic
1074123223 10:110508620-110508642 GCTCCAGAGGCAATACACTCTGG + Intronic
1076560764 10:131361840-131361862 GCTGCATAGGCAACACCTCCAGG + Intergenic
1077368857 11:2172326-2172348 GCTGCAAGGGCCACACCTGCAGG - Intergenic
1078117350 11:8466777-8466799 GCTGCAGGGGCAGGATCTTCAGG - Intronic
1078682132 11:13486984-13487006 CCAGCAGCGGCAACCCATTCGGG - Intergenic
1079478995 11:20861344-20861366 TCTGCAGCGGGAACATATTCAGG + Intronic
1084552977 11:69859607-69859629 CCAGCAGGGGCAACTCACTCGGG + Intergenic
1086009753 11:82086335-82086357 GCTGCAGGAAGAAAACATTCTGG + Intergenic
1086566835 11:88236667-88236689 GCTGCAAGGGCCACAAATACAGG - Intergenic
1086609467 11:88737305-88737327 GCTGTAGAGGCTACACATGCAGG - Intronic
1087795834 11:102453963-102453985 GCTGCAGGGGAAACATTTGCAGG - Intronic
1088358566 11:108968222-108968244 GGTTCAGGGGCAAGAAATTCTGG - Intergenic
1090250536 11:125247814-125247836 GATACAGGGGCAATACATTAAGG - Intronic
1090378834 11:126310805-126310827 GCTGCAGGAACTGCACATTCAGG - Intronic
1090646977 11:128774161-128774183 GGGGCAGGGGCAACACGTGCTGG + Intronic
1091250755 11:134141829-134141851 GCTGCAGGAGGTACACATGCAGG + Intronic
1092774074 12:11927036-11927058 GCTGCATGACAAACACATTCTGG - Intergenic
1093580903 12:20783319-20783341 CCAGCAGTGGCAACCCATTCAGG - Intergenic
1094061938 12:26323570-26323592 TCTGCAGGTGAGACACATTCTGG - Intergenic
1094487796 12:30938705-30938727 GCTTCAGGGGTGACCCATTCAGG - Intronic
1095403483 12:41841580-41841602 GCTTCAGAGGTAACACATTCAGG - Intergenic
1097043805 12:56172490-56172512 TCTGCAGGGGAAACACAGGCAGG + Exonic
1099190057 12:79553287-79553309 CCAGCAGGGGCAACTCAGTCCGG - Intergenic
1099484441 12:83211024-83211046 GCTTCAGGGTCAGAACATTCTGG + Intergenic
1100904775 12:99285535-99285557 TCTGCAGGGGCAACAATTGCTGG - Intronic
1102579464 12:113877070-113877092 GCTGCAGGGGCAGCCCAGTGGGG - Intronic
1102610623 12:114108803-114108825 GCTGCAGTGGCAACTGAATCTGG - Intergenic
1102894368 12:116586827-116586849 TCTTCAAGGGCAACACATTTAGG + Intergenic
1105209165 13:18247735-18247757 GCTGCAGGGAGGACACATACAGG - Intergenic
1105534719 13:21254759-21254781 ACTGCAGGGTTATCACATTCAGG + Intergenic
1106221158 13:27747571-27747593 CCAGCAGTGGCAACACACTCGGG - Intergenic
1109411263 13:61972430-61972452 CCTGCAGCGGCAACCCACTCGGG - Intergenic
1110380413 13:74843999-74844021 GCTCCAGGGGCAGCAAATTGTGG - Intergenic
1111364141 13:87219218-87219240 GGTGCAGGGTCGACACTTTCTGG - Intergenic
1111441388 13:88286066-88286088 GCTGCAGGGGCAGAACCCTCAGG - Intergenic
1113134117 13:107070532-107070554 GCTGCCTGAGCAACACAGTCAGG + Intergenic
1114904675 14:27112187-27112209 GCTTCAGGGGGAACACGTGCAGG + Intergenic
1117629576 14:57676392-57676414 GACGCAGGGGCAACACACACTGG + Intronic
1124143948 15:27103481-27103503 GCTGCAGGGGCAACCCTGTACGG - Intronic
1124711306 15:32014602-32014624 GCAGCAGGGGCAACTAGTTCTGG + Intergenic
1126004053 15:44239864-44239886 GCTTTAGGGGCAACACAATTGGG + Intergenic
1129607802 15:77033268-77033290 GCTGCAGTGGCAACGCTGTCTGG + Intronic
1131865702 15:96707014-96707036 TATGCAGGGGGCACACATTCTGG + Intergenic
1131965491 15:97837877-97837899 GCTGCAAGTGCCACACAGTCTGG + Intergenic
1132345138 15:101103485-101103507 GCTGCTGGGAGAACTCATTCTGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133612060 16:7442563-7442585 GTTGCAGGGACAACTCATTAGGG - Intronic
1134879037 16:17728180-17728202 TCTGCAGGGGGAACAGATCCTGG + Intergenic
1142170992 16:88622732-88622754 GGTGGAGGGGCAACAGTTTCAGG - Intronic
1142291808 16:89196494-89196516 GCTGGTGGGGCAACAGATTGGGG + Intronic
1143837110 17:9701313-9701335 GCTGCGGGGGCCTCACAGTCCGG + Intronic
1144265385 17:13563325-13563347 GCAGAAGGGACAACATATTCTGG + Intronic
1144783531 17:17819612-17819634 GCTGCTGGGGGACCACACTCTGG + Exonic
1147310426 17:39592783-39592805 GCCACAGGAGCCACACATTCAGG - Intergenic
1149070667 17:52538355-52538377 GCTGCAGGCCCAACACAGTTTGG - Intergenic
1150792362 17:68208598-68208620 CCAGCAGTGGCAACCCATTCAGG + Intergenic
1152875958 17:82786368-82786390 CCTGCAGAGGCACCACACTCGGG - Intronic
1155796579 18:30045008-30045030 GCTGCGGGGGCTACAAAGTCTGG - Intergenic
1160038004 18:75319168-75319190 GCTGCAGGGGCTGAGCATTCAGG + Intergenic
1160961787 19:1725455-1725477 GCCGCAGGGGCCCCACAGTCGGG - Intergenic
1161597565 19:5158594-5158616 GCAGCAGCGGCAACCCACTCGGG - Intronic
1166852234 19:45766473-45766495 GCTGCAGGGGCCCCACAGCCTGG + Exonic
1167781077 19:51599278-51599300 CCTGCAGCGGCAACTCATTTGGG + Intergenic
925656292 2:6153040-6153062 GATGCTGGGGCAACAGAGTCTGG - Intergenic
931283441 2:60813378-60813400 GCTGCAGGAGCAACACATTTTGG + Intergenic
932759534 2:74430316-74430338 GCAGCTGGGGGAACACATCCAGG - Exonic
937080626 2:119137201-119137223 GCTGCAGGGGCCAAACACTGTGG + Intergenic
937771892 2:125729042-125729064 CCAGCAGGGGCAACCCACTCAGG + Intergenic
940190521 2:151036008-151036030 GCTGCAGAGCCAGCACACTCAGG + Intronic
941933907 2:170968523-170968545 GCTGGAGGGGCAGCACAGTGGGG + Intergenic
942111716 2:172689046-172689068 CCAGCAGTGGCAACACACTCGGG - Intergenic
948827143 2:240578273-240578295 GCTGCAGGGACAGCACAGCCTGG - Exonic
948896907 2:240931856-240931878 GCTGCAGGGGCAGCACACCAGGG + Intronic
1169220687 20:3820647-3820669 GCTGCAGGGGCAACACATTCAGG + Exonic
1170104314 20:12737156-12737178 GCAGCAAAGGCAACACATTTTGG - Intergenic
1170967988 20:21093309-21093331 GTTGCAGGGAGAACATATTCGGG + Intergenic
1171290338 20:23979448-23979470 GCTGCAGGGAGGACACATACAGG - Intergenic
1172237112 20:33385037-33385059 TCTGCAGGGGTAGCAGATTCAGG + Intronic
1173826263 20:46049658-46049680 GCTGGGGGTGCACCACATTCTGG - Exonic
1175628307 20:60508995-60509017 TCTGCAGTGGCATCACATTTTGG + Intergenic
1175962723 20:62645306-62645328 GCTGCTGGGACAACAGACTCTGG + Intronic
1177691183 21:24509719-24509741 GCAGCAGCAGCAACCCATTCAGG + Intergenic
1179171761 21:38978428-38978450 GATGCAGGGGGTACACATTCAGG + Intergenic
1179776866 21:43670122-43670144 GATGCAGGGTCAACACAGTTAGG + Intronic
1181401650 22:22653423-22653445 GCTGCAGGGAGGACACATACAGG + Intergenic
1181703608 22:24634520-24634542 GCTGCAGGGAGGACACATACAGG + Intergenic
949924503 3:9030526-9030548 GCAGCAATGCCAACACATTCAGG + Intronic
950879624 3:16312555-16312577 GCTGCAGGGAGCACACAGTCTGG - Intronic
951610762 3:24490631-24490653 GCATCAGGGGCCACATATTCAGG + Intronic
952011147 3:28902600-28902622 CCAGCAGTGGCAACCCATTCGGG - Intergenic
952200728 3:31124668-31124690 GCTCTAGGGGCAGCACATTGTGG - Intergenic
953227669 3:41035274-41035296 GCTGCATGGGCATCTCATGCAGG + Intergenic
959871543 3:111334173-111334195 GCAGCAGGGGCAAGAAATTTGGG + Intronic
960745912 3:120888465-120888487 GCTCTAGAGGCAACACATCCTGG - Intergenic
961939085 3:130618711-130618733 CCTGCATGGGAAACACAATCAGG + Intronic
962383636 3:134915907-134915929 CCAGCAGTGGCAACCCATTCGGG - Intronic
967006566 3:185388981-185389003 GCAGCAGAGGCAGTACATTCTGG + Intronic
967805475 3:193711400-193711422 CCTCCAGGGCCCACACATTCAGG - Intergenic
968561350 4:1284714-1284736 GCTGCAGGGGGTCCACATCCTGG - Intergenic
969522342 4:7685809-7685831 GCTGCAGGAGGGACACAGTCAGG - Intronic
970169493 4:13275581-13275603 GCAGCTGGGGCATCACATTTAGG - Intergenic
970851959 4:20613755-20613777 GATGCTGAGGCAACACCTTCAGG - Intronic
971149922 4:24021082-24021104 GCTTCAAGGCCAACACATTTTGG - Intergenic
971528247 4:27650540-27650562 GCTGCAGGAGTAACATATTTTGG + Intergenic
975174156 4:71268260-71268282 GTTGGAGGGGCAATTCATTCTGG + Intronic
975208337 4:71669885-71669907 GCAGCAGTGGCAACCCACTCAGG + Intergenic
978148185 4:105402432-105402454 ACTGTAGGAGCAACTCATTCAGG + Intronic
978999450 4:115199730-115199752 GCAGCAGTGGCAACCCACTCAGG - Intergenic
979128582 4:117009493-117009515 GATACAGGGGGTACACATTCAGG - Intergenic
980217343 4:129869481-129869503 ACTGCAGGGCCAACACTTGCTGG + Intergenic
983991008 4:174119635-174119657 GATTCAGGGGCTACACATGCAGG - Intergenic
985541263 5:488759-488781 GGTGCAGGGGCACCGCATGCTGG + Intronic
987217672 5:15754420-15754442 GCAGCAGGGGCATCACATGGTGG + Intronic
993853031 5:93034997-93035019 ACTCCAGGAGCAACACATCCAGG - Intergenic
994123660 5:96146286-96146308 GCTGCATGAGAATCACATTCAGG + Intergenic
995457426 5:112367007-112367029 GCTGCAGGGACAACACACAGAGG + Intronic
996988965 5:129604875-129604897 ACTTCAGGGGCAACACTTTTAGG - Intronic
998624704 5:143833077-143833099 GCTCCAGGATCAACATATTCAGG + Intergenic
1000541656 5:162548702-162548724 CCAGCAGGGGCAACCCACTCGGG + Intergenic
1002467511 5:179415017-179415039 GCTGGAGGGGCACCCCACTCAGG - Intergenic
1003376567 6:5583796-5583818 ACTGCAGGGTTATCACATTCAGG - Intronic
1003766939 6:9248347-9248369 GCTCCAGGGTCACCACACTCTGG - Intergenic
1003825040 6:9943002-9943024 GCTGCAGTGGCAACCCAGTCTGG + Intronic
1004159738 6:13202893-13202915 GGTGCAAGGTCACCACATTCAGG - Intronic
1007359160 6:41342796-41342818 GGTGCAGGGACAACTCAGTCAGG + Intronic
1010217374 6:73415846-73415868 CCAGCAGGGGGAACATATTCAGG + Intronic
1012691254 6:102314409-102314431 TCTTCAGGGGCATCATATTCAGG + Intergenic
1013113729 6:107084911-107084933 CCAGCAGTGGCAACCCATTCGGG + Intronic
1013166690 6:107600354-107600376 GCTGCAGGGCCACTACATCCTGG - Intronic
1014332790 6:120091725-120091747 GCTTCAAGGGCTCCACATTCTGG + Intergenic
1015853859 6:137603013-137603035 GCTGCAGAGACAATACATTATGG - Intergenic
1019904784 7:4053539-4053561 GCTCCAGGGGCAGCACAGTCAGG - Intronic
1022958124 7:35400136-35400158 GCTGCAGGGCGAGCACATCCAGG - Intergenic
1023276879 7:38529362-38529384 GATCCAGGGACAACACATTGAGG - Intronic
1024002106 7:45196863-45196885 GCAGGAGGGACCACACATTCTGG + Intergenic
1024238917 7:47418978-47419000 GCTGCAGGGGCAGCACCAACCGG + Intronic
1026504120 7:70967799-70967821 CCTGAAGGGGCAAGCCATTCTGG + Intergenic
1027371581 7:77511426-77511448 GGTGCAGGGGGTACACATGCAGG - Intergenic
1028046152 7:86121643-86121665 ACTGCAGGAACAACACATACTGG + Intergenic
1029473080 7:100766785-100766807 GCAGCAGGGGCAGCATTTTCAGG + Intronic
1029922770 7:104283273-104283295 GCTCCAGGGGAAACACAGCCTGG - Intergenic
1030015121 7:105211520-105211542 GGTGCAGGCGCAACACAGTGTGG + Intronic
1032057483 7:128695425-128695447 GCTGCAGGGAGACCCCATTCCGG - Intergenic
1038413182 8:27374135-27374157 GCAGCAGGGGCTGCACATTGGGG + Intronic
1039068979 8:33633406-33633428 CCAGCAGTGGCAACCCATTCAGG - Intergenic
1039577266 8:38633591-38633613 GCTGCTGGGGCATCAAATTGTGG + Intergenic
1043881120 8:85544346-85544368 GCTGAAGGGCCATCACGTTCGGG + Intergenic
1051314036 9:15809807-15809829 GCAGCAGTGGCAACCCGTTCGGG - Intronic
1051449267 9:17177850-17177872 CCAGCAGTGGCAACCCATTCAGG - Intronic
1052290111 9:26830535-26830557 CCAGCAGTGGCAACCCATTCGGG + Intergenic
1056105117 9:83339603-83339625 GCTCCAGGGCCAACTCCTTCAGG + Intronic
1057307430 9:93920440-93920462 GATGCTGGGGGAACAGATTCTGG + Intergenic
1057482242 9:95454290-95454312 CCTGCAGGGGTCACACGTTCAGG - Intronic
1059267080 9:113044648-113044670 GCTGCAGGAGCAATATATTATGG - Intronic
1060473770 9:123970309-123970331 GCTGCACGTGCAGCCCATTCGGG + Intergenic
1060968986 9:127727297-127727319 GCTGCAGGGCCAAGGCCTTCTGG - Exonic
1188617471 X:32176087-32176109 GATGTAGGGGCAAAGCATTCCGG - Intronic
1194876979 X:99201325-99201347 GCTGCAGGGGCAGGGCATTCAGG + Intergenic
1196175985 X:112639413-112639435 GCTGGAGGGGTAGGACATTCTGG + Intronic
1197110688 X:122770930-122770952 GAAGCAGGGGTAAGACATTCCGG - Intergenic
1198841850 X:140865534-140865556 GCAGCAGGTGCAACACAGTGGGG - Intergenic
1200569343 Y:4808786-4808808 GCAGCCTGGGCAACACAGTCAGG + Intergenic
1201619058 Y:15934884-15934906 GATGCAGGGGGTACAAATTCAGG + Intergenic