ID: 1169223727

View in Genome Browser
Species Human (GRCh38)
Location 20:3842805-3842827
Sequence CTTGGCTCACTTCAGCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169223727_1169223734 4 Left 1169223727 20:3842805-3842827 CCCAGGAGCTGAAGTGAGCCAAG No data
Right 1169223734 20:3842832-3842854 CTCCTCCTGAGACCCCTGAGAGG No data
1169223727_1169223738 13 Left 1169223727 20:3842805-3842827 CCCAGGAGCTGAAGTGAGCCAAG No data
Right 1169223738 20:3842841-3842863 AGACCCCTGAGAGGTAAGGCAGG No data
1169223727_1169223737 9 Left 1169223727 20:3842805-3842827 CCCAGGAGCTGAAGTGAGCCAAG No data
Right 1169223737 20:3842837-3842859 CCTGAGACCCCTGAGAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169223727 Original CRISPR CTTGGCTCACTTCAGCTCCT GGG (reversed) Intergenic