ID: 1169223728

View in Genome Browser
Species Human (GRCh38)
Location 20:3842806-3842828
Sequence GCTTGGCTCACTTCAGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169223728_1169223738 12 Left 1169223728 20:3842806-3842828 CCAGGAGCTGAAGTGAGCCAAGC No data
Right 1169223738 20:3842841-3842863 AGACCCCTGAGAGGTAAGGCAGG No data
1169223728_1169223737 8 Left 1169223728 20:3842806-3842828 CCAGGAGCTGAAGTGAGCCAAGC No data
Right 1169223737 20:3842837-3842859 CCTGAGACCCCTGAGAGGTAAGG No data
1169223728_1169223734 3 Left 1169223728 20:3842806-3842828 CCAGGAGCTGAAGTGAGCCAAGC No data
Right 1169223734 20:3842832-3842854 CTCCTCCTGAGACCCCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169223728 Original CRISPR GCTTGGCTCACTTCAGCTCC TGG (reversed) Intergenic