ID: 1169223729

View in Genome Browser
Species Human (GRCh38)
Location 20:3842823-3842845
Sequence GGTCTCAGGAGGAGGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169223729_1169223737 -9 Left 1169223729 20:3842823-3842845 CCAAGCCCCCTCCTCCTGAGACC No data
Right 1169223737 20:3842837-3842859 CCTGAGACCCCTGAGAGGTAAGG No data
1169223729_1169223738 -5 Left 1169223729 20:3842823-3842845 CCAAGCCCCCTCCTCCTGAGACC No data
Right 1169223738 20:3842841-3842863 AGACCCCTGAGAGGTAAGGCAGG No data
1169223729_1169223744 29 Left 1169223729 20:3842823-3842845 CCAAGCCCCCTCCTCCTGAGACC No data
Right 1169223744 20:3842875-3842897 CCCTATTACGTCCCACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169223729 Original CRISPR GGTCTCAGGAGGAGGGGGCT TGG (reversed) Intergenic