ID: 1169223730

View in Genome Browser
Species Human (GRCh38)
Location 20:3842828-3842850
Sequence TCAGGGGTCTCAGGAGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169223730_1169223738 -10 Left 1169223730 20:3842828-3842850 CCCCCTCCTCCTGAGACCCCTGA No data
Right 1169223738 20:3842841-3842863 AGACCCCTGAGAGGTAAGGCAGG No data
1169223730_1169223744 24 Left 1169223730 20:3842828-3842850 CCCCCTCCTCCTGAGACCCCTGA No data
Right 1169223744 20:3842875-3842897 CCCTATTACGTCCCACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169223730 Original CRISPR TCAGGGGTCTCAGGAGGAGG GGG (reversed) Intergenic
No off target data available for this crispr