ID: 1169223730 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:3842828-3842850 |
Sequence | TCAGGGGTCTCAGGAGGAGG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1169223730_1169223738 | -10 | Left | 1169223730 | 20:3842828-3842850 | CCCCCTCCTCCTGAGACCCCTGA | No data | ||
Right | 1169223738 | 20:3842841-3842863 | AGACCCCTGAGAGGTAAGGCAGG | No data | ||||
1169223730_1169223744 | 24 | Left | 1169223730 | 20:3842828-3842850 | CCCCCTCCTCCTGAGACCCCTGA | No data | ||
Right | 1169223744 | 20:3842875-3842897 | CCCTATTACGTCCCACATCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1169223730 | Original CRISPR | TCAGGGGTCTCAGGAGGAGG GGG (reversed) | Intergenic | ||