ID: 1169223734

View in Genome Browser
Species Human (GRCh38)
Location 20:3842832-3842854
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169223728_1169223734 3 Left 1169223728 20:3842806-3842828 CCAGGAGCTGAAGTGAGCCAAGC No data
Right 1169223734 20:3842832-3842854 CTCCTCCTGAGACCCCTGAGAGG No data
1169223727_1169223734 4 Left 1169223727 20:3842805-3842827 CCCAGGAGCTGAAGTGAGCCAAG No data
Right 1169223734 20:3842832-3842854 CTCCTCCTGAGACCCCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169223734 Original CRISPR CTCCTCCTGAGACCCCTGAG AGG Intergenic