ID: 1169223735

View in Genome Browser
Species Human (GRCh38)
Location 20:3842834-3842856
Sequence TACCTCTCAGGGGTCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169223735_1169223744 18 Left 1169223735 20:3842834-3842856 CCTCCTGAGACCCCTGAGAGGTA No data
Right 1169223744 20:3842875-3842897 CCCTATTACGTCCCACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169223735 Original CRISPR TACCTCTCAGGGGTCTCAGG AGG (reversed) Intergenic