ID: 1169223738

View in Genome Browser
Species Human (GRCh38)
Location 20:3842841-3842863
Sequence AGACCCCTGAGAGGTAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169223730_1169223738 -10 Left 1169223730 20:3842828-3842850 CCCCCTCCTCCTGAGACCCCTGA No data
Right 1169223738 20:3842841-3842863 AGACCCCTGAGAGGTAAGGCAGG No data
1169223729_1169223738 -5 Left 1169223729 20:3842823-3842845 CCAAGCCCCCTCCTCCTGAGACC No data
Right 1169223738 20:3842841-3842863 AGACCCCTGAGAGGTAAGGCAGG No data
1169223727_1169223738 13 Left 1169223727 20:3842805-3842827 CCCAGGAGCTGAAGTGAGCCAAG No data
Right 1169223738 20:3842841-3842863 AGACCCCTGAGAGGTAAGGCAGG No data
1169223728_1169223738 12 Left 1169223728 20:3842806-3842828 CCAGGAGCTGAAGTGAGCCAAGC No data
Right 1169223738 20:3842841-3842863 AGACCCCTGAGAGGTAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169223738 Original CRISPR AGACCCCTGAGAGGTAAGGC AGG Intergenic