ID: 1169223739

View in Genome Browser
Species Human (GRCh38)
Location 20:3842844-3842866
Sequence GAGCCTGCCTTACCTCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169223739_1169223744 8 Left 1169223739 20:3842844-3842866 CCCCTGAGAGGTAAGGCAGGCTC No data
Right 1169223744 20:3842875-3842897 CCCTATTACGTCCCACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169223739 Original CRISPR GAGCCTGCCTTACCTCTCAG GGG (reversed) Intergenic
No off target data available for this crispr