ID: 1169223744

View in Genome Browser
Species Human (GRCh38)
Location 20:3842875-3842897
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169223731_1169223744 23 Left 1169223731 20:3842829-3842851 CCCCTCCTCCTGAGACCCCTGAG No data
Right 1169223744 20:3842875-3842897 CCCTATTACGTCCCACATCATGG No data
1169223740_1169223744 7 Left 1169223740 20:3842845-3842867 CCCTGAGAGGTAAGGCAGGCTCA No data
Right 1169223744 20:3842875-3842897 CCCTATTACGTCCCACATCATGG No data
1169223732_1169223744 22 Left 1169223732 20:3842830-3842852 CCCTCCTCCTGAGACCCCTGAGA No data
Right 1169223744 20:3842875-3842897 CCCTATTACGTCCCACATCATGG No data
1169223729_1169223744 29 Left 1169223729 20:3842823-3842845 CCAAGCCCCCTCCTCCTGAGACC No data
Right 1169223744 20:3842875-3842897 CCCTATTACGTCCCACATCATGG No data
1169223735_1169223744 18 Left 1169223735 20:3842834-3842856 CCTCCTGAGACCCCTGAGAGGTA No data
Right 1169223744 20:3842875-3842897 CCCTATTACGTCCCACATCATGG No data
1169223741_1169223744 6 Left 1169223741 20:3842846-3842868 CCTGAGAGGTAAGGCAGGCTCAT No data
Right 1169223744 20:3842875-3842897 CCCTATTACGTCCCACATCATGG No data
1169223736_1169223744 15 Left 1169223736 20:3842837-3842859 CCTGAGACCCCTGAGAGGTAAGG No data
Right 1169223744 20:3842875-3842897 CCCTATTACGTCCCACATCATGG No data
1169223739_1169223744 8 Left 1169223739 20:3842844-3842866 CCCCTGAGAGGTAAGGCAGGCTC No data
Right 1169223744 20:3842875-3842897 CCCTATTACGTCCCACATCATGG No data
1169223730_1169223744 24 Left 1169223730 20:3842828-3842850 CCCCCTCCTCCTGAGACCCCTGA No data
Right 1169223744 20:3842875-3842897 CCCTATTACGTCCCACATCATGG No data
1169223733_1169223744 21 Left 1169223733 20:3842831-3842853 CCTCCTCCTGAGACCCCTGAGAG No data
Right 1169223744 20:3842875-3842897 CCCTATTACGTCCCACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169223744 Original CRISPR CCCTATTACGTCCCACATCA TGG Intergenic