ID: 1169228884

View in Genome Browser
Species Human (GRCh38)
Location 20:3873772-3873794
Sequence TTGTTGTTTACAAATTACCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 630
Summary {0: 1, 1: 0, 2: 14, 3: 96, 4: 519}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169228881_1169228884 8 Left 1169228881 20:3873741-3873763 CCCAGCCTCTAGAACTGTGAGAA 0: 165
1: 1280
2: 2694
3: 3658
4: 3777
Right 1169228884 20:3873772-3873794 TTGTTGTTTACAAATTACCCAGG 0: 1
1: 0
2: 14
3: 96
4: 519
1169228880_1169228884 24 Left 1169228880 20:3873725-3873747 CCTTGATCTTGGACTTCCCAGCC 0: 1034
1: 2703
2: 3854
3: 4002
4: 4272
Right 1169228884 20:3873772-3873794 TTGTTGTTTACAAATTACCCAGG 0: 1
1: 0
2: 14
3: 96
4: 519
1169228883_1169228884 3 Left 1169228883 20:3873746-3873768 CCTCTAGAACTGTGAGAAATAAT 0: 8
1: 296
2: 1857
3: 4040
4: 6335
Right 1169228884 20:3873772-3873794 TTGTTGTTTACAAATTACCCAGG 0: 1
1: 0
2: 14
3: 96
4: 519
1169228882_1169228884 7 Left 1169228882 20:3873742-3873764 CCAGCCTCTAGAACTGTGAGAAA 0: 208
1: 1968
2: 4608
3: 6004
4: 5568
Right 1169228884 20:3873772-3873794 TTGTTGTTTACAAATTACCCAGG 0: 1
1: 0
2: 14
3: 96
4: 519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169228884 Original CRISPR TTGTTGTTTACAAATTACCC AGG Exonic
901410464 1:9079436-9079458 CTGTCGGTTACACATTACCCTGG + Intronic
902100895 1:13987841-13987863 CTGTTCTTTGTAAATTACCCAGG - Intergenic
902445795 1:16463335-16463357 CTTTTGTTTATAAACTACCCAGG - Intergenic
902707835 1:18218084-18218106 CTTTTCTTTATAAATTACCCAGG - Intronic
903441587 1:23391967-23391989 CTGTTGTTTATAAACTACCCAGG + Intronic
906037207 1:42758690-42758712 TTGTTTATAACAAACTACCCAGG + Intronic
907295104 1:53445909-53445931 TTTTTTTTTATAAATTACCTAGG - Intergenic
907661156 1:56393621-56393643 TAGTTCTTTACAGATTACCTTGG - Intergenic
907764747 1:57398033-57398055 TTGTTGTTAACAATTTTACCAGG - Intronic
908057208 1:60301114-60301136 TTTTTCTTTCCAAATTTCCCTGG + Intergenic
908499488 1:64729040-64729062 CTGTCTTTTATAAATTACCCAGG + Intergenic
909574704 1:77160278-77160300 TTTTTCTTTATAAATTACCCAGG + Intronic
909589370 1:77328853-77328875 CCGTTCTTTATAAATTACCCAGG - Intronic
909983939 1:82137206-82137228 CTGTTGTTTATAAATTACCTGGG - Intergenic
910007098 1:82411132-82411154 TTGTTGTTTATATATCACCCAGG + Intergenic
910633238 1:89379050-89379072 CTTTTCTTTATAAATTACCCAGG - Intronic
913118724 1:115720182-115720204 CTGTTGTTTATAAGCTACCCAGG - Intronic
913594475 1:120360228-120360250 TTATTATTTACAAATCAGCCAGG + Intergenic
914092789 1:144518758-144518780 TTATTATTTACAAATCAGCCAGG - Intergenic
914305741 1:146415117-146415139 TTATTATTTACAAATCAGCCAGG + Intergenic
914596315 1:149157689-149157711 TTATTATTTACAAATCAGCCAGG - Intergenic
914867578 1:151444858-151444880 TTTTTTTTTAAAAATTAGCCAGG + Intronic
915505972 1:156356812-156356834 ATATTGTTTACAAATTAATCCGG + Intronic
915739617 1:158108831-158108853 CTTTTCTTTATAAATTACCCAGG - Intergenic
916929985 1:169566985-169567007 TTGCTGTTAACAAAGTACCCTGG + Intronic
917005048 1:170405754-170405776 CTGTTGTTTTTAAATTACCCAGG + Intergenic
918626768 1:186664451-186664473 CTGATGTTTATAAATTACCGAGG - Intergenic
918644696 1:186889923-186889945 TTGTTGTAGTCAAATGACCCAGG + Intronic
918696032 1:187547604-187547626 TTTTTGTTTTCAAATCAGCCTGG + Intergenic
918820992 1:189253923-189253945 TTGTTTTTTAAAGATCACCCTGG - Intergenic
918916794 1:190651055-190651077 TTTTTATTTCCAAATTACCCTGG - Intergenic
919000289 1:191823220-191823242 CTTTTCTTTATAAATTACCCAGG + Intergenic
919025944 1:192170530-192170552 ATGTTCTTTATAAATTACTCAGG + Intronic
919410592 1:197237268-197237290 CTATTGTTTATACATTACCCAGG - Intergenic
919628116 1:199932353-199932375 CTATTGCTTATAAATTACCCAGG + Intergenic
919688870 1:200510581-200510603 TCACTGTTTACAAATTAGCCGGG - Intergenic
919719128 1:200813060-200813082 CTGCTGTTTATAAATTACCTAGG - Intronic
919791770 1:201295828-201295850 TTCTTGGTTACAAATTTCCATGG - Intronic
920565538 1:206969843-206969865 TTTTTGGTTCTAAATTACCCAGG + Intronic
920618930 1:207524914-207524936 CTTTTCTTTATAAATTACCCAGG - Intronic
920620714 1:207543481-207543503 CTTTTCTTTATAAATTACCCAGG - Intronic
920622496 1:207562038-207562060 CTTTTCTTTATAAATTACCCAGG - Intronic
920909165 1:210198178-210198200 CTGTTGTCTATAAGTTACCCAGG - Intergenic
923625794 1:235612821-235612843 TTGTAGTTTAAAAGCTACCCAGG - Intronic
924610359 1:245568352-245568374 ATGTTTTTTAAAAATTAGCCAGG + Intronic
924895528 1:248334368-248334390 CTGTTGTTTATAAACTACCCAGG - Intergenic
1062846614 10:712045-712067 TTTTTCTTTATAAATTACCCAGG + Intergenic
1063098790 10:2931744-2931766 TTCTTCTTTGTAAATTACCCAGG + Intergenic
1063568084 10:7189983-7190005 TTGTTGTTTTCAAATAAATCAGG - Intronic
1065086225 10:22180162-22180184 TTTTTCTTTATAAATTACCCAGG + Intergenic
1065182439 10:23140105-23140127 TGTTTCTTTATAAATTACCCAGG + Intergenic
1065241492 10:23709365-23709387 TAGTTTTTTAAAAATTAGCCAGG + Intronic
1065490330 10:26275997-26276019 TTGTTTTTTTTAAATTAGCCAGG + Intronic
1065619772 10:27569171-27569193 TTTTTCTTTATAAATTACCCAGG - Intergenic
1065692152 10:28345535-28345557 CTTTTCTTTATAAATTACCCAGG + Intergenic
1065698807 10:28404741-28404763 TTATTTTTTAAAAATTAGCCAGG + Intergenic
1066497000 10:35951809-35951831 ATTTTTTTTAAAAATTACCCAGG - Intergenic
1066642979 10:37574810-37574832 CTGCTGTTTGTAAATTACCCAGG + Intergenic
1067052581 10:43030751-43030773 CTGTTCTTTATAAATTACCCAGG - Intergenic
1067151854 10:43742457-43742479 TCTTTTTTTATAAATTACCCAGG - Intergenic
1067512652 10:46908724-46908746 TTGTTCTTTACAAATTATCCAGG + Intergenic
1067649592 10:48143098-48143120 TTGTTCTTTACAAATTATCCAGG - Intergenic
1068044149 10:51863762-51863784 CTGTTCCTTATAAATTACCCAGG + Intronic
1068297986 10:55100454-55100476 TTTTACTTTACAAATTGCCCAGG - Intronic
1068484222 10:57636036-57636058 CTGTTCTTTATAAACTACCCAGG - Intergenic
1068579029 10:58718155-58718177 CTGTTGTTTACAAATTACTCAGG - Intronic
1069381251 10:67844897-67844919 ATATTCTTTATAAATTACCCAGG + Intergenic
1070653011 10:78251777-78251799 CTGTTGTTCATAAACTACCCAGG - Intergenic
1072951722 10:99852754-99852776 TTGTGATTTACAAATTCTCCAGG + Intergenic
1073665708 10:105531342-105531364 GTGGTGTTTAAAAATTAGCCTGG - Intergenic
1074596415 10:114871851-114871873 TTGTTTTTTCTACATTACCCCGG + Intronic
1074674112 10:115828593-115828615 TTGTTGTTTTCTAATTCCTCAGG + Intronic
1075166396 10:120071783-120071805 CTATTCTTTATAAATTACCCAGG - Intergenic
1075359589 10:121818570-121818592 TTTTTCTTTACAAATAACCATGG - Intronic
1076455545 10:130591296-130591318 TCTTTCTTTACAAATTACCCAGG - Intergenic
1078079219 11:8192043-8192065 CTTTTCTTTATAAATTACCCAGG + Intergenic
1078622709 11:12923639-12923661 TTGTTCTTTATAAATTACCCAGG - Intronic
1078851134 11:15164983-15165005 TTTTTCCTTATAAATTACCCAGG + Intronic
1078877374 11:15412071-15412093 ATGGTGTTTTCAAATTTCCCAGG - Intergenic
1078934769 11:15941184-15941206 CTGTCGTTTAAAAATAACCCAGG + Intergenic
1079542510 11:21593266-21593288 TTTTTCTTTATAAATTACCCAGG + Intergenic
1079592433 11:22196128-22196150 ATTTTCTTTATAAATTACCCAGG - Intronic
1079685496 11:23354236-23354258 TTTTTTTTTAAAAATTAGCCAGG - Intergenic
1079715499 11:23738505-23738527 TATTTGTTTTCAATTTACCCTGG + Intergenic
1079767989 11:24418382-24418404 TGATTATTTACATATTACCCTGG + Intergenic
1079778032 11:24558921-24558943 TGGTTGTTTATAAATTACCCAGG + Intronic
1080377465 11:31730212-31730234 CTATTGTTTATAAATTACCCAGG - Intronic
1080891518 11:36412644-36412666 TTGTTCTTTACAAATTAAATTGG + Intronic
1082917771 11:58457046-58457068 TTGTTGTTGCCTAATTACTCTGG - Intergenic
1083773394 11:64880583-64880605 GTTTTGTTTATAAATAACCCAGG - Intronic
1084153744 11:67303021-67303043 CTGGGGTTTACAAATAACCCAGG - Intergenic
1084498299 11:69518617-69518639 CTTTTCTTTATAAATTACCCAGG + Intergenic
1084577355 11:69997942-69997964 CTTTTCTTTATAAATTACCCAGG + Intergenic
1084798182 11:71523280-71523302 CTGTTCTTTATCAATTACCCAGG - Intronic
1085172092 11:74457999-74458021 TTTTTCTTTATAAACTACCCAGG + Intronic
1086768545 11:90730525-90730547 GTGTTGTGAACAGATTACCCTGG - Intergenic
1087115301 11:94518426-94518448 TGGATTTTTACAAATTTCCCAGG + Intergenic
1087462353 11:98461689-98461711 CTGTTTTTTATAAATTACGCAGG + Intergenic
1087511444 11:99100992-99101014 TTTTTCTTTATAAATTACCCAGG - Intronic
1087834282 11:102855919-102855941 TTGTTTTTGACAAATGACCTGGG - Intergenic
1088983128 11:114881832-114881854 TTATTGTTTACAAAGTAGACAGG - Intergenic
1091161362 11:133424021-133424043 CTGTTATTTATAAATTACCCAGG + Intronic
1092347584 12:7728647-7728669 TTTTTGTTAAAAAATTAGCCAGG - Intergenic
1092645795 12:10570765-10570787 TTGTGGTTTAAAAATTAACAGGG - Intergenic
1093206459 12:16257275-16257297 TTTTTGCTTGAAAATTACCCGGG + Intronic
1093253046 12:16832198-16832220 TTTTCCTTTATAAATTACCCAGG - Intergenic
1093351338 12:18106312-18106334 CTGTTCTTTATAAATTATCCTGG + Intronic
1093515598 12:19982889-19982911 CTGTTGTTTGTAAGTTACCCAGG + Intergenic
1093621537 12:21296399-21296421 TTTTTGTTTTTAAATTAGCCAGG - Intronic
1093628331 12:21378733-21378755 TAGCTGTTTACAATTTACCAAGG - Exonic
1093953133 12:25187063-25187085 TTTCTGTTTACAACTTTCCCAGG + Intronic
1094794253 12:33951878-33951900 TTTTTGTATATAAATTACCCAGG + Intergenic
1095106103 12:38234492-38234514 TTTTTGTATATAAATTACCCAGG + Intergenic
1095611987 12:44139881-44139903 TTGTTGTTTACAATCCAACCAGG + Intronic
1095730100 12:45497365-45497387 CTGTTCATTATAAATTACCCCGG + Intergenic
1096327321 12:50675933-50675955 ATGTTGTTTACAATTTAGACGGG + Intronic
1096335308 12:50750871-50750893 CTGTTCTTTATAAACTACCCAGG + Intergenic
1096902487 12:54899864-54899886 CTTTTCTTTATAAATTACCCAGG - Intergenic
1097302320 12:58032249-58032271 CTTTTATTTATAAATTACCCAGG - Intergenic
1097416226 12:59319676-59319698 TTATTGTTGACATATCACCCAGG + Intergenic
1097882250 12:64696499-64696521 TTTTTGTTTATAAATTCCCAAGG + Exonic
1098655243 12:73019859-73019881 ATTTTCTTTAAAAATTACCCAGG + Intergenic
1099079592 12:78160066-78160088 TTGTTATTTCAAAATTACACAGG - Intronic
1099175241 12:79413966-79413988 TTTTTGTTTACAATTTAGGCTGG + Intronic
1099475899 12:83107293-83107315 CTTTTCTTTATAAATTACCCAGG - Intronic
1099518501 12:83629297-83629319 TTGTATTTTACAACTTTCCCTGG + Intergenic
1099593339 12:84624183-84624205 CTGTTGTTTATAAACTACTCAGG + Intergenic
1099617893 12:84962122-84962144 TTGTTTTTGAAAAATTACCTAGG + Intergenic
1099658170 12:85521986-85522008 TTGTAGTTTAAAAATTACTCTGG - Intergenic
1099994024 12:89757174-89757196 TTTTAGTTTACAAATACCCCTGG + Intergenic
1100116356 12:91309614-91309636 TTAGTGTTTAAAAATTACACTGG - Intergenic
1100698626 12:97122536-97122558 TTGTTGCTTAGAAATAACCTTGG + Intergenic
1101110469 12:101481345-101481367 TTTATATTTAAAAATTACCCAGG - Intronic
1101355933 12:103977705-103977727 TGGTGCTTTACAAATTAGCCTGG + Intronic
1101696592 12:107132914-107132936 TTTTTCTTTATAAATTACCCAGG + Intergenic
1103925104 12:124419334-124419356 TGTTTGTTTACATATTACCATGG - Intronic
1105615456 13:22008004-22008026 CTTTTCTTTATAAATTACCCAGG + Intergenic
1106947881 13:34848800-34848822 CTTTTCTTTATAAATTACCCAGG + Intergenic
1107349154 13:39496153-39496175 CTGTTGTTTATAAGTTACTCGGG - Intronic
1108032237 13:46244611-46244633 TTTCTGTTTAGAAATTAGCCAGG + Intronic
1110171392 13:72505053-72505075 TTGCTTTTTATAAATTACTCAGG + Intergenic
1110240608 13:73262361-73262383 CTTTTCTTTATAAATTACCCAGG - Intergenic
1110849506 13:80229054-80229076 TCTTTCTTTATAAATTACCCAGG - Intergenic
1110862599 13:80359460-80359482 TTGTTCTTTACAAATAACTCAGG + Intergenic
1111309376 13:86462354-86462376 TTTTTTTTTACAAATGCCCCTGG - Intergenic
1111403199 13:87768530-87768552 TTTTTCTTTATAAATTACCCTGG - Intergenic
1111815308 13:93145531-93145553 CTTTTGTTTATCAATTACCCAGG + Intergenic
1112006778 13:95260323-95260345 TTTTTGTTTTAAAATTCCCCAGG - Intronic
1112263754 13:97903147-97903169 CTGTTCTTTATAAATTACCCAGG - Intergenic
1113273419 13:108700674-108700696 TTGTTTTCTACAAATGCCCCAGG - Intronic
1114147291 14:19992864-19992886 CTTTTCTTTATAAATTACCCGGG - Intergenic
1114714942 14:24815036-24815058 TTTTTGTTTAAAAATTCCCTAGG + Intronic
1115630521 14:35240310-35240332 TTTTGGTTTAAAATTTACCCGGG + Intronic
1115718334 14:36130535-36130557 TTTTTCTTTATAAATTACTCAGG + Intergenic
1115835941 14:37402786-37402808 TTGCTGTTTAAAAATAAGCCAGG - Intronic
1118831737 14:69439947-69439969 TTGACCTTTATAAATTACCCCGG - Intronic
1119148753 14:72339389-72339411 CTATTGTTTATAAGTTACCCCGG + Intronic
1120376812 14:83719130-83719152 CTGTTGTTTAGAAATTATCCAGG - Intergenic
1120428798 14:84387320-84387342 TTTTTCTTTCTAAATTACCCAGG + Intergenic
1120516912 14:85481836-85481858 TTATTGTTTAAAAATTATTCAGG - Intergenic
1120609558 14:86623415-86623437 TTTTTCTTCATAAATTACCCAGG + Intergenic
1121344704 14:93126994-93127016 CTTTTCTTTATAAATTACCCAGG - Intergenic
1122368583 14:101214321-101214343 TTTTTCTTTAAAAATTACCTAGG - Intergenic
1123907677 15:24936527-24936549 CTTTTCTTTATAAATTACCCAGG - Intronic
1124040430 15:26097190-26097212 TTATGATTTATAAATTACCCAGG - Intergenic
1125154325 15:36568988-36569010 TTGTTGTTTACAAAAAACCCAGG + Intergenic
1125289992 15:38135857-38135879 CTTTTCTTTATAAATTACCCAGG - Intergenic
1125523223 15:40359399-40359421 TTATTGTTAACACATTAGCCTGG + Intronic
1125763170 15:42112551-42112573 CTTTTCTTTATAAATTACCCAGG - Intergenic
1126246522 15:46512304-46512326 CTTTTCTTTATAAATTACCCAGG + Intergenic
1126309495 15:47299665-47299687 TTCTTGATGACAAACTACCCTGG + Intronic
1126346483 15:47700248-47700270 TTGATGTTTACAAAATAGCTTGG - Intronic
1126793939 15:52244729-52244751 TTGTTTGTTTAAAATTACCCTGG + Intronic
1128015403 15:64340794-64340816 TAGTTTTTTAAAAATTAGCCAGG + Intronic
1129151392 15:73690446-73690468 TTTTTCTTTATATATTACCCAGG - Intronic
1129163546 15:73761691-73761713 CTTTTGTTTATAAATTACCCAGG + Intergenic
1130939750 15:88497659-88497681 TTTGTGTTTTCAGATTACCCTGG - Intergenic
1130973390 15:88753226-88753248 TTATTGTTTCCAAGCTACCCAGG + Intergenic
1131041475 15:89271657-89271679 AAATTGTTTACAAATTAGCCAGG - Intronic
1132068269 15:98751358-98751380 TTTTTTTTTAGAAATTACCTGGG - Intronic
1132347642 15:101118155-101118177 CTGTTCTTTATAAATAACCCAGG - Intergenic
1133434098 16:5764469-5764491 CTTTTCTTTATAAATTACCCAGG + Intergenic
1134264478 16:12681445-12681467 CTGTTCTTTATAAATTACCCAGG + Intronic
1134798067 16:17059745-17059767 TTTTTGTTTTAAAGTTACCCAGG - Intergenic
1135676759 16:24421665-24421687 CTTTTCTTTATAAATTACCCAGG + Intergenic
1135680974 16:24456312-24456334 CTTTTCTTTATAAATTACCCAGG + Intergenic
1136734287 16:32449680-32449702 CTTTTGTTTATTAATTACCCAGG + Intergenic
1137385639 16:48040323-48040345 CTTTTCTTTACAAATTACTCAGG - Intergenic
1138112351 16:54334148-54334170 ATGTTTTTTAAAAATTAGCCAGG - Intergenic
1138735642 16:59247511-59247533 CTTTTCTTTATAAATTACCCAGG + Intergenic
1139212648 16:65094916-65094938 CTCTTGGTTATAAATTACCCAGG + Intronic
1139542195 16:67626512-67626534 TTTGTGTTTTCACATTACCCTGG + Intronic
1140097659 16:71889086-71889108 ATGTTTTTTAAAAATTAGCCAGG + Intronic
1140241838 16:73209327-73209349 CTATTGTTCATAAATTACCCAGG - Intergenic
1140654633 16:77126960-77126982 TTACTCTTTATAAATTACCCAGG - Intergenic
1140706347 16:77633938-77633960 TTATTTTTTAAAAATTAGCCAGG + Intergenic
1140948464 16:79793460-79793482 TTTTAATTTACAAATTACCTGGG + Intergenic
1141457603 16:84154172-84154194 TTGTTGTCTACAAGCCACCCAGG - Intronic
1203018791 16_KI270728v1_random:379922-379944 CTTTTGTTTATTAATTACCCAGG - Intergenic
1203037126 16_KI270728v1_random:653080-653102 CTTTTGTTTATTAATTACCCAGG - Intergenic
1144064720 17:11614596-11614618 CTGCTCTTTATAAATTACCCAGG - Intronic
1144968955 17:19095077-19095099 TTGTTGTTTTTTAATTAGCCAGG - Intronic
1144978961 17:19156989-19157011 TTGTTGTTTTTTAATTAGCCAGG + Intronic
1144989261 17:19221243-19221265 TTGTTGTTTTTTAATTAGCCAGG - Intronic
1145918650 17:28593023-28593045 TTGTTATTTACAAAATCCACTGG + Exonic
1148523925 17:48311414-48311436 TTTTTGTATAAAAATTAGCCAGG + Intronic
1148900347 17:50870912-50870934 TTATTTTTTAAAAATTAGCCGGG + Intergenic
1148901171 17:50878622-50878644 TTCTTGGTTACATATTACACAGG - Intergenic
1149258609 17:54855325-54855347 TATTTTTTTATAAATTACCCAGG - Intergenic
1150572056 17:66394934-66394956 CTTTAGTTTATAAATTACCCTGG + Intronic
1150883731 17:69061000-69061022 CTGTTTTATACAAATTTCCCAGG + Exonic
1151071694 17:71221065-71221087 TTGTGGTATCCAAATTACTCAGG - Intergenic
1151102904 17:71575839-71575861 TTGTTGTTTATAATTTCCCTAGG + Intergenic
1151435569 17:74094289-74094311 CTATTGTTTATAAATTTCCCAGG - Intergenic
1151929734 17:77224732-77224754 GTTTTCTTTATAAATTACCCAGG - Intergenic
1153316127 18:3724171-3724193 TTGTTTTTTAAAAATTAGCCGGG + Intronic
1153585294 18:6614658-6614680 GTGTTGTTTATAAATCACCCAGG - Intergenic
1153615761 18:6931453-6931475 TTTTTCTTTATAAATTACCCAGG + Intergenic
1154956070 18:21256503-21256525 TAGTTGTTTTCACATCACCCTGG - Intronic
1155198014 18:23493232-23493254 CTTTTCTTTATAAATTACCCAGG - Intergenic
1156044701 18:32864442-32864464 ATATTGTTTATAAATTACCCAGG + Intergenic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1156243930 18:35279543-35279565 CTGTTGTTTATAAGCTACCCAGG - Intronic
1156515426 18:37675296-37675318 TTTTTGTTAAGAAATTCCCCTGG - Intergenic
1156904587 18:42337887-42337909 CTTTTGTTTATAAATTACCCAGG - Intergenic
1156939814 18:42753655-42753677 GTGTTGTTCACAAATTTCTCAGG - Intronic
1157037536 18:43993480-43993502 TTCTTGTATATAAATTATCCTGG + Intergenic
1157346559 18:46841337-46841359 TTGTTTTTGCCAAATAACCCAGG + Intronic
1158418669 18:57273232-57273254 ATGTTATTTATAAATCACCCAGG + Intergenic
1158744394 18:60182067-60182089 TTGTTGTTTACACAATACACTGG + Intergenic
1158860994 18:61592244-61592266 CTTTTCTTTATAAATTACCCAGG + Intergenic
1159422203 18:68235943-68235965 TTGTTTTTTACAAATAAAACAGG + Intergenic
1159651870 18:70987339-70987361 ATTTTCTTTATAAATTACCCAGG + Intergenic
1161730264 19:5955946-5955968 TTTTTTTTTTCAAATTAGCCAGG + Intronic
1161968823 19:7564277-7564299 TTTTTTTTTAAAAATTATCCAGG - Intergenic
1162608041 19:11726737-11726759 TTTGTTTTTATAAATTACCCAGG + Intronic
1162678918 19:12323639-12323661 TTGTTCCTTATAAATTATCCAGG + Intronic
1162843090 19:13370726-13370748 TTTTTTTTTAGAAATTAGCCAGG - Intronic
1163265985 19:16222366-16222388 TTTTTTTTTAAAAATTAGCCAGG - Intronic
1164849881 19:31472671-31472693 TTTTTCTTTATAAATTATCCAGG - Intergenic
1165169092 19:33878573-33878595 TGGTTGTTTACAAAATACTCAGG + Intergenic
1166967929 19:46541633-46541655 TTTTTGCTTACAATTCACCCAGG - Intronic
1167082314 19:47285325-47285347 TTTCTCTTTATAAATTACCCAGG + Intergenic
1168468172 19:56620690-56620712 TTTTTTTTTAAAAATTAGCCAGG - Intronic
925038854 2:714645-714667 TTCTTCTCTACAAATTCCCCTGG - Intergenic
925047830 2:788104-788126 CTCTTGTTTATAAATTACCCAGG - Intergenic
925423942 2:3733521-3733543 CTGCTGTTTATAAATTACCCAGG - Intronic
925437571 2:3853755-3853777 TTGTTTTTGACAAATGTCCCAGG + Intergenic
925603165 2:5629576-5629598 TTATTATTTACAAATCAGCCAGG + Intergenic
926311940 2:11681562-11681584 CTTTTCTTTATAAATTACCCAGG + Intronic
926942113 2:18149537-18149559 ATTTTCTTTATAAATTACCCAGG - Intronic
927242269 2:20929488-20929510 CTTTTCTTTACAAATTACCCAGG - Intergenic
927392850 2:22614818-22614840 TTGTTTTTTAAAAATTACTTGGG - Intergenic
928475407 2:31621795-31621817 TAGTTTTTTAAAAATTAGCCAGG - Intergenic
929732422 2:44509943-44509965 TTTTTCTTTGTAAATTACCCAGG + Intronic
929890029 2:45911170-45911192 TTTTTCTTTACAAATTTCCAGGG + Intronic
931269604 2:60689771-60689793 CTTTTCTTTATAAATTACCCAGG + Intergenic
932043445 2:68323226-68323248 CTGTTGTTTATAAATTATCCAGG + Intergenic
933033162 2:77358171-77358193 CTTTTCTTTATAAATTACCCAGG - Intronic
933083960 2:78031379-78031401 TTCTTCTTTACAAATGATCCTGG + Intergenic
933290910 2:80437189-80437211 CTGTCGTTGATAAATTACCCAGG + Intronic
934674862 2:96242363-96242385 TTGGAGTTTACAAATGACTCAGG - Intergenic
934942456 2:98512443-98512465 CTTTTCTTTACAAACTACCCAGG - Intronic
935862494 2:107348305-107348327 CTTTTATTTATAAATTACCCAGG - Intergenic
935964554 2:108461048-108461070 CTTTTCTTTATAAATTACCCAGG + Intronic
936845080 2:116821411-116821433 TTTTTTCTTACAAATTACCCAGG - Intergenic
936989947 2:118352562-118352584 TTGTTATATGCAAATTACCTAGG - Intergenic
937864802 2:126741601-126741623 TTTTTCTTTATAAATTACCCAGG + Intergenic
938089301 2:128420800-128420822 CTGTTCTTTATAAATTACCCAGG + Intergenic
938118540 2:128618343-128618365 TTGTTCTTTATAAATTACTCTGG + Intergenic
938660181 2:133478570-133478592 TGGCTGTTTACAAAGTGCCCTGG - Intronic
938745000 2:134269131-134269153 CTTTTCTTTATAAATTACCCAGG - Intronic
938921982 2:136003524-136003546 ATGTTTTTTAAAAATTAGCCAGG - Intergenic
939043735 2:137224031-137224053 CTTTTCTTTATAAATTACCCAGG + Intronic
940038883 2:149338687-149338709 CTGTTATTTATAAATTACCCCGG + Intronic
940491026 2:154360962-154360984 TTTTTGTTTTCAAATTTCCTAGG - Intronic
940884750 2:158979330-158979352 TTTTTTTTTAAAAATTAGCCAGG + Intronic
941205523 2:162567998-162568020 TTTTAATTTATAAATTACCCAGG - Intronic
942151482 2:173080382-173080404 TTGTTCCTTGTAAATTACCCAGG - Intronic
942709170 2:178813203-178813225 CTATTGTTTATAAATTACCTAGG + Intronic
943283977 2:185972996-185973018 CTTTTCTTTATAAATTACCCAGG + Intergenic
943385010 2:187191949-187191971 TTTTTCTTTATAAATTACTCTGG + Intergenic
944508188 2:200437150-200437172 CTTTTCTTTAAAAATTACCCAGG + Intronic
945144575 2:206724077-206724099 TTGGTATTTATAAATTACACTGG - Intergenic
945188230 2:207161400-207161422 TTTGTGTCTACAAATTTCCCTGG + Intronic
945358033 2:208861455-208861477 CTTTTCTTTATAAATTACCCAGG + Intergenic
946151126 2:217771712-217771734 TTGTTTTTTAAAAATAACGCAGG - Intergenic
946582826 2:221148881-221148903 CTTTTCTTTATAAATTACCCAGG + Intergenic
946962702 2:225001683-225001705 TTGTTGTTTATAAACCACCCAGG - Intronic
947421396 2:229944138-229944160 CTTTTCTTTATAAATTACCCAGG + Intronic
947665626 2:231903723-231903745 CTGTTCTTTATAAATTACCCAGG - Intergenic
948532872 2:238623877-238623899 CTTTTCTTTATAAATTACCCAGG - Intergenic
1169228884 20:3873772-3873794 TTGTTGTTTACAAATTACCCAGG + Exonic
1169379474 20:5094399-5094421 TTTTTTTTTAAAAATTAGCCAGG - Intronic
1169520691 20:6369945-6369967 TTGATGTTTCCAAAGTACCTAGG - Intergenic
1170211434 20:13849489-13849511 TTGTTGCTTAGAAATCACCATGG - Exonic
1170273207 20:14551525-14551547 TTTTTGTTTACAAATATGCCAGG + Intronic
1170838733 20:19906954-19906976 CTGTTCTTTATAAATTAGCCAGG - Intronic
1170928223 20:20745114-20745136 GTTTTCTTTATAAATTACCCAGG + Intergenic
1173574604 20:44104071-44104093 TTGTTGTTTATAAGGTACCCAGG + Intergenic
1174150588 20:48483530-48483552 TTGTTGTTTACTAAATGCACAGG - Intergenic
1174407415 20:50311217-50311239 CTGTTCTTTGTAAATTACCCAGG + Intergenic
1175250010 20:57603569-57603591 CTGTTGCTTATAAATTACCCAGG - Intergenic
1175253683 20:57625308-57625330 CTATTGTTTATAAATTACCTAGG - Intergenic
1175311583 20:58015432-58015454 GTGTTGTTTGCCAATTACCATGG + Intergenic
1175563226 20:59950937-59950959 CTTTTCTTTATAAATTACCCAGG - Intergenic
1176061119 20:63173453-63173475 TTGGTGTCAGCAAATTACCCTGG - Intergenic
1176872591 21:14095666-14095688 CTGTTGTTGCCAAATTCCCCTGG - Intergenic
1177376798 21:20280620-20280642 TTTTTCTTTATAAATTACCCAGG + Intergenic
1177671299 21:24232740-24232762 GTTTTATTTTCAAATTACCCAGG - Intergenic
1177707018 21:24719769-24719791 CTGTTGTTTATAAACTACCCAGG - Intergenic
1177815968 21:25977035-25977057 TTTTTCTTTACAGATTATCCAGG + Intronic
1178215733 21:30595846-30595868 TTTTTGTTTTCAAATTTCCATGG + Intergenic
1178338493 21:31765418-31765440 GTTTTCTTTATAAATTACCCAGG + Intergenic
1178579912 21:33829613-33829635 TTGTTTTTCAGAAATTGCCCAGG + Exonic
1178694323 21:34780090-34780112 CTTTTCTTTATAAATTACCCAGG + Intergenic
1178762567 21:35417696-35417718 CTGTCATTTTCAAATTACCCTGG - Intronic
1179125713 21:38588884-38588906 TTTTTTTTTAAAAATTAGCCAGG - Intronic
1179147227 21:38778742-38778764 CTTTTCTTTATAAATTACCCAGG + Intergenic
1179523796 21:41962455-41962477 ATGTTGTTTACAAGCCACCCGGG - Intergenic
1180247474 21:46557799-46557821 TTGTTGTTTTTAAACTTCCCAGG - Intronic
1180319858 22:11310004-11310026 TTGTTGTTTACCTGTCACCCAGG + Intergenic
1180633865 22:17248744-17248766 CTTTTCTTTATAAATTACCCAGG + Intergenic
1181383682 22:22527688-22527710 TTTTTCTTTATAAATTACCCAGG + Intergenic
1181612564 22:24027836-24027858 TGTTTTTTTATAAATTACCCAGG + Intronic
1181883699 22:26001850-26001872 TTCTTGTTTACTATTTACCCTGG - Intronic
1182824274 22:33250348-33250370 TTGATGTTTATACATTAACCTGG + Intronic
1184081023 22:42220321-42220343 TTATTTTTTAAAAATTAGCCAGG - Intronic
1184838682 22:47039740-47039762 CTTTTCTTTACAAATGACCCAGG - Intronic
949179364 3:1109391-1109413 TTCTTGTTTACAATTTACCAAGG + Intronic
950952102 3:17011327-17011349 TTGTAATTTACAAAGTCCCCTGG - Exonic
951351812 3:21615390-21615412 CTTTTCTTTATAAATTACCCAGG + Intronic
951778236 3:26334093-26334115 TTTTTCTCTATAAATTACCCAGG + Intergenic
952743697 3:36758666-36758688 CTGTTCTTTACAAATTACCCAGG + Intergenic
952997761 3:38901858-38901880 TTGTTGTTTTCCAAGTACACAGG - Intronic
953085055 3:39657182-39657204 CTGTTATTTATAAACTACCCAGG - Intergenic
953230209 3:41058067-41058089 TTTTTCTTTATAAATTACCCAGG - Intergenic
954517782 3:51195123-51195145 TTGCTGTTTACAAAAAACTCGGG - Intronic
955474802 3:59325795-59325817 CTTTTCTTTATAAATTACCCAGG - Intergenic
955566837 3:60256415-60256437 TTGTTGTTTCTAAATCACCCAGG + Intronic
955949556 3:64228539-64228561 TTTTTTTTTACAAATTATACTGG + Intronic
957012692 3:75026631-75026653 CTGTTATTTATAAATTGCCCAGG + Intergenic
957251112 3:77772166-77772188 TTTTTCTTTATAAATTACCCAGG - Intergenic
957271153 3:78031568-78031590 CTATTGTTTAAAAAATACCCAGG + Intergenic
959177938 3:102940418-102940440 TTTTCCTTTATAAATTACCCAGG + Intergenic
959188459 3:103078062-103078084 CTGTTCTTTATAAATTAACCAGG + Intergenic
959351408 3:105269208-105269230 CTTTTCTTTATAAATTACCCAGG + Intergenic
960424830 3:117493527-117493549 CTTTCGTTTATAAATTACCCAGG - Intergenic
960463334 3:117964261-117964283 TTTTTGTTTATAAATTACCCAGG + Intergenic
960524348 3:118692329-118692351 TTTTTCTCTATAAATTACCCAGG + Intergenic
962619217 3:137160317-137160339 CTTTTATTTATAAATTACCCAGG + Intergenic
963077925 3:141365279-141365301 CTTTTCTTTATAAATTACCCAGG - Intronic
963404754 3:144848564-144848586 CTGTTGTTTATAAGCTACCCAGG + Intergenic
964015869 3:151945728-151945750 CTGTTGTTTATAACCTACCCTGG + Intergenic
964180447 3:153877541-153877563 TTGTATTTTACAAATTACCGAGG - Intergenic
964825050 3:160816537-160816559 TTGATGTTGAAAAATTTCCCAGG + Intronic
964879369 3:161406542-161406564 TTATTTTTTATAAATTATCCCGG + Intergenic
965279634 3:166733436-166733458 CTGTTGTTTATAAACCACCCAGG - Intergenic
965959606 3:174413203-174413225 TTGTTCTTTATAAATACCCCTGG - Intergenic
966283860 3:178269827-178269849 TTGTTGTTTACAACTTCATCTGG - Intergenic
966720561 3:183058459-183058481 TTTTTTTTTATAAATTAGCCAGG + Intronic
967073154 3:185979645-185979667 TTGTTCTTAAAAGATTACCCCGG + Intergenic
967183068 3:186923134-186923156 TAATTGTTAACAAATTTCCCAGG - Intergenic
967301899 3:188022397-188022419 TTTATGTTTACATTTTACCCTGG - Intergenic
967359854 3:188617709-188617731 TGGTTGTTTAAAAATACCCCAGG + Intronic
967514396 3:190349440-190349462 CTTTTCTTTATAAATTACCCAGG + Intronic
967692529 3:192493540-192493562 CTTTTCTTTATAAATTACCCAGG - Intronic
968980523 4:3846670-3846692 TTTTTCCTTATAAATTACCCAGG + Intergenic
970037472 4:11754012-11754034 CTTTTCTTTATAAATTACCCAGG + Intergenic
970052929 4:11936738-11936760 CTTTTCTTTACAAATTACCCAGG - Intergenic
970987049 4:22171066-22171088 CTGTCTTTTAGAAATTACCCAGG - Intergenic
971501953 4:27327756-27327778 TTGTTGTGATCAAATTTCCCAGG + Intergenic
971606988 4:28670477-28670499 TTGTTCTTCACACATTACCTGGG - Intergenic
971794758 4:31212701-31212723 CTTTTCTTTACAAATTACCTAGG + Intergenic
972041881 4:34612738-34612760 GTTTTCTTTATAAATTACCCAGG - Intergenic
972196030 4:36655099-36655121 CTGTTCTTTATAAATTACTCAGG - Intergenic
972226278 4:37016562-37016584 GTGTTGTTTATAAACTATCCAGG + Intergenic
972444291 4:39128803-39128825 ATGTTTTTTAAAAATTAGCCAGG + Intergenic
973841821 4:54869862-54869884 ACCTTTTTTACAAATTACCCTGG - Intergenic
974013724 4:56630074-56630096 CTTTTCTTTAAAAATTACCCAGG + Intergenic
974060021 4:57024195-57024217 TAGCTTTTTACAAAGTACCCTGG - Intronic
974092222 4:57323050-57323072 GTATTACTTACAAATTACCCGGG - Intergenic
974344527 4:60661985-60662007 CTTTTCTTTATAAATTACCCAGG + Intergenic
974383982 4:61180861-61180883 TTGCTGTTTACCAATTAAACAGG - Intergenic
974441599 4:61925468-61925490 CTTTTCTTTATAAATTACCCAGG - Intronic
974534704 4:63159524-63159546 TTCTAATTTACAAATTACACAGG + Intergenic
974708584 4:65557625-65557647 TTACTTTTTACAAATTTCCCAGG - Intronic
975505885 4:75136837-75136859 TTTTTTTTTACAAATAAGCCAGG - Intergenic
975977234 4:80113261-80113283 TTGATGTTTAAGAATTAGCCAGG - Intronic
976283823 4:83351459-83351481 ATGTTTTTTAAAAATTAGCCAGG - Intergenic
976710897 4:88070790-88070812 TTTTTTTTTAAAAATTAGCCAGG - Intronic
976713081 4:88093993-88094015 TTGTTGTTTTTAAATTAACTTGG - Intronic
977232692 4:94470384-94470406 GAGTTGTTTACAAATTATGCTGG + Intronic
977306070 4:95324876-95324898 CTGTTCTTTATAAACTACCCAGG + Intronic
977612669 4:99052360-99052382 CTTTTCTTTATAAATTACCCAGG - Intronic
977745450 4:100541636-100541658 ATATTATTTAAAAATTACCCAGG + Intronic
977874290 4:102130451-102130473 CTCTTCTTTACAAATTATCCAGG + Intergenic
977939046 4:102838401-102838423 GTGGTGTTTTCAAATTTCCCTGG - Intronic
978018235 4:103775342-103775364 TTTTAGTTTACTAAATACCCTGG + Intergenic
978227259 4:106351926-106351948 CTGTTCTTTCCAAATTCCCCAGG - Intergenic
978920405 4:114176326-114176348 TTCTTCTTTATGAATTACCCAGG - Intergenic
979122595 4:116921662-116921684 CTTTTCTTTATAAATTACCCAGG + Intergenic
979346237 4:119590895-119590917 TGATTGTTTACAAAATATCCTGG - Intronic
979352644 4:119663049-119663071 TCTTTCTTTAGAAATTACCCAGG + Intergenic
979452558 4:120890088-120890110 CTTTTCTTTATAAATTACCCAGG - Intronic
979743992 4:124186544-124186566 CTTTTCTTTATAAATTACCCAGG + Intergenic
980038647 4:127913961-127913983 TTCTTTTTTAAAAATTAGCCAGG - Intergenic
980272348 4:130601657-130601679 TTGTTGTTTATAAATTGAACTGG + Intergenic
981052493 4:140323211-140323233 TTGTTGTTTAGAAAGGAGCCTGG + Intronic
981159000 4:141474530-141474552 CTTTTCTTTACAAACTACCCAGG + Intergenic
981677715 4:147359274-147359296 CTTTTCTTTATAAATTACCCAGG - Intergenic
982456037 4:155610648-155610670 CTTTTCTTTATAAATTACCCAGG - Intergenic
982627014 4:157780139-157780161 CTTTTCTTTATAAATTACCCAGG + Intergenic
983281925 4:165691945-165691967 TGGATCATTACAAATTACCCAGG - Intergenic
983430587 4:167645127-167645149 TTGTTGTGTACAAATACCACAGG + Intergenic
983658280 4:170105858-170105880 CTTTTCTTTATAAATTACCCAGG - Intergenic
983982680 4:174018090-174018112 TTGTGGTGTCCAAATAACCCGGG - Intergenic
984048001 4:174826677-174826699 TTGTTGCCTCCAAATTGCCCTGG + Intronic
984389607 4:179111886-179111908 CTTTTCTTTATAAATTACCCAGG - Intergenic
984399502 4:179243774-179243796 CTGTTGTTTAACAATTACCTAGG - Intergenic
984436302 4:179714171-179714193 CTTTTCTTTATAAATTACCCAGG + Intergenic
985583726 5:715112-715134 TTTTTCTTTATAAATTACCCAGG + Intronic
985597234 5:799409-799431 TTTTTCTTTATAAATTACCCAGG + Intronic
986537393 5:8805086-8805108 TTGTTCTTTATAAATTACCCAGG + Intergenic
987244067 5:16030365-16030387 TTTTTGTTTATAAATTACCCAGG - Intergenic
987560480 5:19513470-19513492 TTGTTTTTAACAATTTACCAGGG + Intronic
987618130 5:20303570-20303592 TTGTTGTTACCAAATGAACCGGG - Intronic
989428596 5:41325798-41325820 CTGTTGTTTATATACTACCCAGG - Intronic
989954582 5:50342391-50342413 TTTTTCTTTTTAAATTACCCAGG + Intergenic
990091451 5:52056080-52056102 CTGTTGTTTATACATTACACTGG - Intronic
990202893 5:53397769-53397791 CTTTTCTTTATAAATTACCCAGG + Intergenic
990319771 5:54618298-54618320 CTGTCTTTTACAAATGACCCAGG + Intergenic
990354440 5:54952045-54952067 CTGTTGTTTATAAATGACCCAGG - Intergenic
990622523 5:57576216-57576238 CTTTTCTTTATAAATTACCCAGG + Intergenic
991025004 5:62019642-62019664 CTTTTCTTTATAAATTACCCAGG + Intergenic
991369207 5:65900838-65900860 CTTTTCTTTATAAATTACCCAGG - Intergenic
991462917 5:66878412-66878434 TTGTTGTGTACAAATTTGCCAGG - Intronic
991491530 5:67188331-67188353 CTTTTCTATACAAATTACCCAGG + Intronic
992157920 5:73972939-73972961 CTGTTGTTTATAAGCTACCCAGG - Intergenic
993351853 5:86859120-86859142 CTTTTCTTTATAAATTACCCAGG + Intergenic
994076100 5:95651553-95651575 ATGTTTTTAAAAAATTACCCAGG - Intronic
994352423 5:98762502-98762524 TTATTGTTTCCAAACTGCCCGGG - Intergenic
994777478 5:104052431-104052453 TTGTTGTTGATAATTTACCTAGG - Intergenic
995344622 5:111097960-111097982 TTGTTGTTTATAGTTTTCCCAGG + Intronic
995425671 5:112019639-112019661 TATTTGGTTAAAAATTACCCTGG + Intergenic
995646166 5:114314737-114314759 TAGTTGTTTAGAGATAACCCAGG + Intergenic
995952777 5:117736757-117736779 GTGTTGTTTTCATTTTACCCAGG + Intergenic
996268327 5:121570894-121570916 TTTCTCTTTATAAATTACCCAGG - Intergenic
998335561 5:141369154-141369176 TTGTTATTTACACTTTTCCCTGG - Intronic
998929310 5:147163064-147163086 TTTTTGCTTTCAAATTATCCTGG + Intergenic
999360771 5:150984803-150984825 TTATTTTTTAAAATTTACCCAGG + Intergenic
1000136957 5:158362364-158362386 CTATTGTTTAGAAATTAGCCAGG - Intergenic
1000198128 5:158979987-158980009 TTTTTGTTTGCAAATGACCGAGG + Intronic
1000407387 5:160902888-160902910 TTGTTGATTACAAACTTCCAAGG - Intergenic
1000695105 5:164371321-164371343 CTTTTATTTATAAATTACCCAGG - Intergenic
1000939218 5:167339957-167339979 CTGTGCTTTATAAATTACCCAGG + Intronic
1001709009 5:173762916-173762938 TTTTTTTTTAAAAATTAGCCAGG + Intergenic
1001923770 5:175621207-175621229 CTATTGTTTATAAATTACCCAGG + Intergenic
1003118605 6:3300605-3300627 CTGTTGTTTATAAATCATCCAGG + Intronic
1003621137 6:7701511-7701533 TTTTTCTTTATAAATTATCCAGG - Intergenic
1003986824 6:11443686-11443708 TTTTTCTTTATAATTTACCCAGG + Intergenic
1004522349 6:16373808-16373830 TTTTTCTTTATAAATTACCTAGG + Intronic
1004712894 6:18189244-18189266 TTGTTGTTTACCAATAACACTGG + Intronic
1004796564 6:19092880-19092902 TTGTTGTTTTTAAATTAGCCAGG - Intergenic
1004804210 6:19184257-19184279 CTTTTGTTTATAAATTACCCAGG + Intergenic
1004900725 6:20191329-20191351 CTATTGTTTACAATTTACCCGGG + Intronic
1006262037 6:32882968-32882990 TTCTGGTTTGCAAATTAGCCTGG + Intergenic
1006673136 6:35742551-35742573 TTGTTTTTCACAAATCCCCCAGG + Intronic
1007028676 6:38605655-38605677 TTTTTGTTTTTAAATTAGCCTGG + Intronic
1007208848 6:40175143-40175165 ATATTTTTTAAAAATTACCCTGG + Intergenic
1008242702 6:49131071-49131093 TTTTTCTTTATAAATTACCCAGG + Intergenic
1008261096 6:49367268-49367290 CTCTTCTTTATAAATTACCCAGG - Intergenic
1008652268 6:53575561-53575583 CTGTTGTTTATAAGCTACCCAGG + Intronic
1009248340 6:61268492-61268514 CTTTTCTTTATAAATTACCCAGG - Intergenic
1009786539 6:68347486-68347508 TTTTTCTTTATAAATTACGCAGG + Intergenic
1010363528 6:75022903-75022925 ATTTTCTTTATAAATTACCCAGG + Intergenic
1010687642 6:78871074-78871096 CTGTTGTTTATAAGCTACCCAGG - Intronic
1010712917 6:79196134-79196156 TTTTTCTTTATAAATTGCCCAGG - Intergenic
1011047823 6:83106392-83106414 TTGTTATTTACAATGTACCTAGG - Intronic
1011916305 6:92510758-92510780 TTTTCTTTTACAAATTACCCAGG + Intergenic
1012043961 6:94245428-94245450 CTCTTCTTTACAAATTACCCAGG - Intergenic
1012794077 6:103737750-103737772 TGGTAATTTAAAAATTACCCAGG + Intergenic
1013396767 6:109748651-109748673 TTTTTCTTTATAAATTACCCAGG - Intronic
1013944889 6:115710560-115710582 TTGTTGTTTGCTAATTTTCCTGG - Intergenic
1014082617 6:117305057-117305079 CTTTTCTTTATAAATTACCCAGG + Intronic
1015589909 6:134813047-134813069 CTTTTCTTTACAAAATACCCGGG + Intergenic
1015846858 6:137530049-137530071 TTGTTATTTCAAAAATACCCAGG + Intergenic
1016300817 6:142629275-142629297 TCGTTTTCTAAAAATTACCCAGG - Intergenic
1016854906 6:148657605-148657627 TTTTGGTTTACAAATTAGACAGG + Intergenic
1017234863 6:152108893-152108915 CTTTTCTTTATAAATTACCCAGG - Intronic
1017723774 6:157262618-157262640 TTATTTTTTAAAAATTAGCCGGG + Intergenic
1017996580 6:159536778-159536800 CTGTTCTTTGTAAATTACCCAGG - Intergenic
1018138683 6:160805242-160805264 TTTTTCTTTATAAATTACCCAGG + Intergenic
1018535561 6:164815120-164815142 CTTTTGTTTATAAATTACCCAGG - Intergenic
1019157330 6:170048080-170048102 TGGTTCTTTATAAATTACCCAGG + Intergenic
1021497650 7:21293790-21293812 CTTTTCTTTATAAATTACCCAGG - Intergenic
1022059873 7:26782907-26782929 CTGTTGATTATAAGTTACCCAGG + Intronic
1022717868 7:32915038-32915060 CTTTTCTTTATAAATTACCCAGG - Intergenic
1022841132 7:34164804-34164826 TTGTTATTTATAAATTACCCAGG + Intergenic
1023107628 7:36778194-36778216 TTATTGTTTACTAATTTGCCTGG - Intergenic
1023246654 7:38212101-38212123 TTGTTTTTCACAGGTTACCCTGG - Intronic
1023385194 7:39649673-39649695 CTGTTCTTTATAAATTACCCAGG + Intronic
1024189413 7:46990545-46990567 TTGTTTTTTATAAATTAACCAGG + Intergenic
1024315965 7:48016786-48016808 CTGTTGTTTATAAATTACCCAGG - Intronic
1024677573 7:51650846-51650868 CTTTTCTTTATAAATTACCCAGG + Intergenic
1026017966 7:66685565-66685587 TTCCTGTTTACAAATTAGCTGGG - Intronic
1026026103 7:66744747-66744769 TTCCTGTTTACAAATTAGCCAGG - Intronic
1026606784 7:71823407-71823429 TGTTTCTTTATAAATTACCCAGG - Intronic
1026686664 7:72515897-72515919 TTTTTCTTTATAAATTACCCAGG + Intergenic
1027842556 7:83331349-83331371 CTGATGTTTATGAATTACCCTGG + Intergenic
1028975450 7:96908038-96908060 CTGCTTTTTATAAATTACCCAGG + Intergenic
1029972469 7:104802661-104802683 CTGTTGTTTATCAGTTACCCAGG + Intronic
1030723256 7:112894486-112894508 TTTTTCTTTATAAATTACCCAGG - Intronic
1030887910 7:114961556-114961578 CTTTTCTTTATAAATTACCCAGG - Intronic
1032430337 7:131855826-131855848 CCTTTCTTTACAAATTACCCAGG + Intergenic
1032906380 7:136372208-136372230 TTGTTGTTAACAAACAAACCTGG + Intergenic
1033874375 7:145796081-145796103 TTGTTTTTTAAAAATCAGCCAGG - Intergenic
1035187150 7:157135421-157135443 CTGTTGTCCAAAAATTACCCAGG - Intergenic
1035575996 8:705672-705694 TTGTTGTTGACTAATTGCCCTGG - Intronic
1036088336 8:5637550-5637572 TTTTTTTTTTCAAATTTCCCTGG - Intergenic
1036122507 8:6033631-6033653 CTTTTCTTTATAAATTACCCAGG + Intergenic
1036378610 8:8221446-8221468 ATGTTTTTTAAAAATTAGCCAGG + Intergenic
1036530101 8:9577393-9577415 CTTTTCTTTATAAATTACCCAGG - Intronic
1038523514 8:28253743-28253765 CTTTTCTTTATAAATTACCCAGG - Intergenic
1038969369 8:32614927-32614949 CAGATGTTGACAAATTACCCAGG - Intronic
1039152059 8:34517370-34517392 TTTTTTTTTCCAAATTTCCCAGG + Intergenic
1039313630 8:36347634-36347656 TTTTTCTTTATAAATTACCCAGG - Intergenic
1039328563 8:36512051-36512073 TTTTTCATTACAAATTACTCAGG - Intergenic
1039574060 8:38609648-38609670 TTTTTCTTTATAAATTACCCAGG - Intergenic
1039594598 8:38779796-38779818 TTGTTGTTAACAAGTTAACTTGG - Intronic
1039660086 8:39451957-39451979 TTGCAGTTTACAAATTTCACTGG - Intergenic
1040025693 8:42779818-42779840 TTTTTGATTACTAATTGCCCTGG + Intronic
1040848585 8:51873863-51873885 ATTTTCTTTAAAAATTACCCAGG + Intronic
1041324566 8:56651209-56651231 TTTTTCTTTATGAATTACCCAGG - Intergenic
1041624882 8:60014421-60014443 TTTTTCTTTATAAATTACCCAGG - Intergenic
1042603762 8:70525804-70525826 TTTTTTTTTAAAAATTAGCCAGG - Intergenic
1043369363 8:79572701-79572723 TAGATGTTTATAAATAACCCAGG + Intergenic
1043377301 8:79665059-79665081 TTGATGTTTAAAAAATACCTTGG + Intronic
1043478312 8:80626633-80626655 TGGTTGTTTTCAGGTTACCCAGG + Intergenic
1043761119 8:84069622-84069644 ATATTGTTTATAAATTATCCAGG - Intergenic
1043925948 8:86037280-86037302 TTTTTTTTTATAAATTACCTAGG + Intronic
1043935285 8:86135839-86135861 TTTTTGTTCAAAAATTACTCAGG + Intronic
1044130117 8:88511866-88511888 TTTTTCTTTACAAATTACTCAGG + Intergenic
1044352159 8:91179168-91179190 CTTTTCTTTATAAATTACCCAGG - Intronic
1044381544 8:91539808-91539830 TTCTTCTTCATAAATTACCCAGG + Intergenic
1044904107 8:96981120-96981142 TTACTATTTACAATTTACCCTGG + Intronic
1044977384 8:97677940-97677962 TTGTTTTTTGCTAATTACCATGG - Intronic
1045076312 8:98573268-98573290 CTTTTCTTTATAAATTACCCAGG - Intronic
1045287921 8:100807836-100807858 CTTTTCTTTATAAATTACCCAGG + Intergenic
1047000296 8:120566522-120566544 CTATTATTTATAAATTACCCAGG + Intronic
1047014664 8:120710815-120710837 TTTTTCTTTATAAATTACCCAGG + Intronic
1047447145 8:124929576-124929598 TTTTTCTTTATAAATTACCCAGG + Intergenic
1048117199 8:131537655-131537677 TTGTTTTTGACAAATGTCCCTGG + Intergenic
1048283032 8:133119401-133119423 ACGTTGTTTATAAATTATCCAGG - Intronic
1048571439 8:135660259-135660281 CTATTGTTAATAAATTACCCAGG - Intergenic
1048651703 8:136485416-136485438 CTTTTCTTTATAAATTACCCGGG - Intergenic
1050074360 9:1848010-1848032 GTGTTGTTTAAAACTAACCCAGG - Intergenic
1050164678 9:2752176-2752198 TTTTTTTTAATAAATTACCCAGG + Intronic
1051173202 9:14340384-14340406 TTCTTTTTTACAAGTTCCCCTGG - Intronic
1051412654 9:16806553-16806575 TTTTTATTTTCTAATTACCCAGG + Intronic
1051531582 9:18109935-18109957 CTGTTGTGTGCAAATTACCTTGG + Intergenic
1052084770 9:24250908-24250930 TTGTTGTTGACCAATTTCTCTGG + Intergenic
1052147290 9:25065684-25065706 TTTTTGCTAATAAATTACCCAGG - Intergenic
1052207519 9:25860974-25860996 CTTTTATTTATAAATTACCCAGG + Intergenic
1055486858 9:76764660-76764682 GTGTTTTATACAAATTACTCTGG + Intronic
1055754039 9:79538042-79538064 TTTTTCTTTATAAATTACCCAGG + Intergenic
1056182307 9:84097230-84097252 CTTTTCTTTATAAATTACCCAGG + Intergenic
1056315481 9:85385524-85385546 CTGTTGTTTATAAATTACCTAGG - Intergenic
1056395591 9:86178570-86178592 CTGCTCTTTATAAATTACCCAGG - Intergenic
1056512507 9:87319355-87319377 CTTTTCTTTATAAATTACCCAGG - Intergenic
1056516129 9:87352058-87352080 CTGTAGTTTATAAATTATCCAGG + Intergenic
1056746296 9:89306635-89306657 CTTTTCTTTATAAATTACCCAGG + Intergenic
1057158650 9:92868517-92868539 CTTTTCTTTATAAATTACCCAGG - Intronic
1057740614 9:97708365-97708387 TTAATTTTTATAAATTACCCAGG + Intergenic
1058013624 9:100004959-100004981 TTGTTTTTTAAAGATTACTCTGG - Intronic
1058133223 9:101277104-101277126 ATTTTGTTTAAAAGTTACCCAGG - Intronic
1058623765 9:106912957-106912979 TTCTTGTTTGCAAAGTATCCTGG - Intronic
1059462508 9:114442823-114442845 CTCTTCTTTATAAATTACCCAGG + Intronic
1059793359 9:117664357-117664379 CTGTTCTTTATAACTTACCCAGG - Intergenic
1060043307 9:120320287-120320309 CTGTTGTTTATAAATTACCCTGG - Intergenic
1060746422 9:126136253-126136275 CTGTCCTTTATAAATTACCCAGG - Intergenic
1061269366 9:129528775-129528797 TTTTTGTGTAAAAATTAGCCTGG - Intergenic
1061344729 9:130013957-130013979 CTACTGTTTATAAATTACCCAGG + Intronic
1061427461 9:130508495-130508517 TTGTTGTTTAAAAAGGAGCCTGG - Intergenic
1203487078 Un_GL000224v1:66406-66428 TTTTTCTTTATAAATCACCCAGG + Intergenic
1203499699 Un_KI270741v1:8306-8328 TTTTTCTTTATAAATCACCCAGG + Intergenic
1185498585 X:580060-580082 CTTTTCTTTATAAATTACCCAGG - Intergenic
1185886039 X:3784084-3784106 TTTTGCTTTATAAATTACCCAGG - Intergenic
1186249718 X:7652640-7652662 CTATTATTTACAAATTACCCAGG + Intergenic
1186988734 X:15044945-15044967 ATGTTGTTTAGAAACTCCCCAGG - Intergenic
1188187157 X:27129799-27129821 TTTTTCTTTATAAATTACCCAGG - Intergenic
1188390192 X:29610536-29610558 CTGTTATTCACACATTACCCAGG - Intronic
1189590028 X:42501005-42501027 TTATTGTTTATAAAGTACCCTGG + Intergenic
1189766506 X:44377747-44377769 CTTTTCTTTATAAATTACCCAGG + Intergenic
1190631467 X:52391303-52391325 TTGTTGTTCCCACATTTCCCTGG - Intergenic
1190635443 X:52428279-52428301 TTGTTGTTCCCACATTTCCCTGG + Intergenic
1190863451 X:54364658-54364680 TTGTTGTTTGCAAAGTAATCTGG + Intergenic
1191607728 X:63080438-63080460 CTTTTCTTTATAAATTACCCAGG + Intergenic
1191845726 X:65546355-65546377 ATGTTGTTTATAAATTATCTTGG - Intergenic
1192578891 X:72264511-72264533 ATGTTTTTTAAAAATTAGCCAGG - Intronic
1193181595 X:78464830-78464852 GTATTGTTTATAAATTACCCAGG - Intergenic
1193596732 X:83455386-83455408 TTAATGTTAACAAATTTCCCCGG - Intergenic
1193939854 X:87668877-87668899 TTTTTCTTTATAAATTACCCAGG + Intronic
1193997331 X:88382911-88382933 GTGTTGTTTATAAATTACCTAGG - Intergenic
1194004559 X:88474604-88474626 ATTTTCTTTATAAATTACCCAGG - Intergenic
1194423928 X:93713571-93713593 CTTTTCTTTACAAATTACCCAGG - Intergenic
1195750688 X:108159924-108159946 TTGTTATTATCAAATTTCCCTGG - Intronic
1196250855 X:113458609-113458631 TTGTTGTTTACAAGTCATTCTGG - Intergenic
1196372130 X:114991030-114991052 TTGTTGTTTATAAGCCACCCAGG + Intergenic
1196404084 X:115346361-115346383 CTCTTGTTTATAAATTACCCAGG + Intergenic
1196580132 X:117369343-117369365 TTGTTGCTTACCAATTATTCTGG + Intergenic
1197397303 X:125942396-125942418 CTTTTCTTTATAAATTACCCAGG - Intergenic
1197527133 X:127577227-127577249 CTTTTATTTATAAATTACCCAGG - Intergenic
1198193545 X:134336191-134336213 TTTTTCTTTATAAATTACCCAGG - Intergenic
1198220753 X:134599545-134599567 TTTTCCTTTATAAATTACCCAGG + Intronic
1199146644 X:144376970-144376992 TTTTTCTTCATAAATTACCCAGG - Intergenic
1199153628 X:144519796-144519818 TTTTTTTTAATAAATTACCCAGG + Intergenic
1199357334 X:146876830-146876852 CTTTTTTTTATAAATTACCCAGG + Intergenic
1200331876 X:155306458-155306480 TTTTTCTTTATAATTTACCCAGG + Intronic
1200474164 Y:3624103-3624125 ATTTTCTTTACAAATCACCCAGG - Intergenic
1200759063 Y:7019923-7019945 TGGTTTTTTACAAATTGTCCTGG + Intronic
1201261338 Y:12161725-12161747 TTTTTCTTTGTAAATTACCCAGG - Intergenic
1201369439 Y:13245682-13245704 TTGTTCTTTACACATATCCCAGG - Intergenic
1201465423 Y:14275245-14275267 CTGTTATTTACAAATTACCCGGG + Intergenic
1201689334 Y:16745446-16745468 TTGTTGTTTACTGAATAACCTGG - Intergenic
1201721581 Y:17104245-17104267 TTTTTCTTTATAAATTACTCAGG - Intergenic
1201856362 Y:18548820-18548842 GTTTGCTTTACAAATTACCCAGG - Intronic
1201876959 Y:18771564-18771586 GTTTGCTTTACAAATTACCCAGG + Intronic
1201921771 Y:19241383-19241405 TTTTTCTTGATAAATTACCCAGG + Intergenic
1202138335 Y:21691658-21691680 TAATTGTTTAAAAATTAGCCAGG - Intergenic