ID: 1169229032

View in Genome Browser
Species Human (GRCh38)
Location 20:3874792-3874814
Sequence CTGAACATACAACTGGACAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 1, 2: 20, 3: 62, 4: 227}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169229032_1169229042 30 Left 1169229032 20:3874792-3874814 CCATTGTCCAGTTGTATGTTCAG 0: 1
1: 1
2: 20
3: 62
4: 227
Right 1169229042 20:3874845-3874867 AGGGGCCACCATCGCTGGAATGG 0: 1
1: 0
2: 0
3: 14
4: 111
1169229032_1169229036 -7 Left 1169229032 20:3874792-3874814 CCATTGTCCAGTTGTATGTTCAG 0: 1
1: 1
2: 20
3: 62
4: 227
Right 1169229036 20:3874808-3874830 TGTTCAGTCTCTTGGAAGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 212
1169229032_1169229039 11 Left 1169229032 20:3874792-3874814 CCATTGTCCAGTTGTATGTTCAG 0: 1
1: 1
2: 20
3: 62
4: 227
Right 1169229039 20:3874826-3874848 GAAGGGTATTGACTCTGAGAGGG 0: 1
1: 0
2: 0
3: 18
4: 217
1169229032_1169229041 25 Left 1169229032 20:3874792-3874814 CCATTGTCCAGTTGTATGTTCAG 0: 1
1: 1
2: 20
3: 62
4: 227
Right 1169229041 20:3874840-3874862 CTGAGAGGGGCCACCATCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1169229032_1169229038 10 Left 1169229032 20:3874792-3874814 CCATTGTCCAGTTGTATGTTCAG 0: 1
1: 1
2: 20
3: 62
4: 227
Right 1169229038 20:3874825-3874847 GGAAGGGTATTGACTCTGAGAGG 0: 1
1: 0
2: 0
3: 15
4: 142
1169229032_1169229040 12 Left 1169229032 20:3874792-3874814 CCATTGTCCAGTTGTATGTTCAG 0: 1
1: 1
2: 20
3: 62
4: 227
Right 1169229040 20:3874827-3874849 AAGGGTATTGACTCTGAGAGGGG 0: 1
1: 0
2: 1
3: 9
4: 160
1169229032_1169229037 -6 Left 1169229032 20:3874792-3874814 CCATTGTCCAGTTGTATGTTCAG 0: 1
1: 1
2: 20
3: 62
4: 227
Right 1169229037 20:3874809-3874831 GTTCAGTCTCTTGGAAGGAAGGG 0: 1
1: 0
2: 2
3: 18
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169229032 Original CRISPR CTGAACATACAACTGGACAA TGG (reversed) Exonic
901351826 1:8604183-8604205 CTGATCGTACAACTAGTCAATGG + Intronic
902039098 1:13479967-13479989 CTGAACATCCTACAGGACACAGG - Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904118210 1:28177603-28177625 TAGAACATTCTACTGGACAATGG - Intronic
904118562 1:28179955-28179977 TAGAACATTCTACTGGACAATGG + Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
906871233 1:49483671-49483693 CAGGACATAGAACTGGGCAAAGG + Intronic
907957737 1:59246971-59246993 GTGAGCACACACCTGGACAAGGG - Intergenic
908968616 1:69797459-69797481 ATTAACAGAGAACTGGACAATGG - Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
910154616 1:84200550-84200572 CTGGACATAAGAATGGACAAAGG - Intronic
912214757 1:107596234-107596256 CAGAACATTCAGCTGGACAGAGG - Exonic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
912989708 1:114473342-114473364 GTGAACGCACACCTGGACAAGGG + Intronic
913503589 1:119495309-119495331 CTGAAGATTCCACTGGAGAAAGG + Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918487882 1:185048254-185048276 CACAACATAAAACTGGATAATGG - Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922889973 1:229054303-229054325 CTGGACATCAAACTTGACAAGGG + Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924665660 1:246069034-246069056 CTGAAAATATAACATGACAAAGG + Intronic
1062917814 10:1255431-1255453 CATAACATACAACACGACAAAGG + Intronic
1063927035 10:10989831-10989853 CTGACCATAAAAGTAGACAAAGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066752683 10:38674897-38674919 CTCAACAAAAAAATGGACAAAGG + Intergenic
1066964350 10:42248129-42248151 CTCAACAAAAAAATGGACAAAGG - Intergenic
1067071230 10:43133729-43133751 CTGAACATGCAAACAGACAATGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG + Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075213676 10:120513177-120513199 GGGAACATACAACTGGAGAGGGG - Intronic
1078758865 11:14235717-14235739 ATGCACAGTCAACTGGACAATGG + Intronic
1078888374 11:15529213-15529235 CTGAACAACCAACAGGTCAAAGG + Intergenic
1079060505 11:17244682-17244704 CTGAACATATTACTAGAAAAGGG + Intronic
1079621724 11:22563909-22563931 CTGGACATAGGAATGGACAAAGG - Intergenic
1079904554 11:26229457-26229479 GTGAACATAAAACAGGAAAATGG + Intergenic
1080856854 11:36119660-36119682 CTCAACTTACAAATGGGCAAAGG - Intronic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1083772925 11:64878457-64878479 CTGAACATACTGCCGGACACGGG + Exonic
1084063531 11:66690515-66690537 CTGAAAGTTCAACTGGCCAATGG - Intronic
1085537558 11:77232508-77232530 TAGAACATGCAACTGGACACTGG + Intronic
1086085245 11:82946386-82946408 AAGAACATACAATTGGAAAAGGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086692550 11:89804743-89804765 CTGAACATAGATCTGGAAATTGG + Intronic
1086713250 11:90034916-90034938 CTGAACATAGATCTGGAAATTGG - Intronic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094425908 12:30316863-30316885 CTGAACAGACAAGAGGACAAAGG + Intergenic
1095034940 12:37351904-37351926 CTTCACATACAACTAGACAGAGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1098598863 12:72305600-72305622 ATGTACCTACAACTGGAGAAAGG + Intronic
1101156981 12:101936931-101936953 CTCACCATATAACTGGAGAAAGG - Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105384756 13:19919370-19919392 CTTACCATACAACTTAACAATGG - Intergenic
1105458797 13:20565478-20565500 GTGAGCACACACCTGGACAAGGG - Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106356006 13:28984016-28984038 CTGAACATAGAGCTGGAAACAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106912155 13:34474516-34474538 CTTATCATATCACTGGACAAAGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107429882 13:40330902-40330924 GTGAGCACACACCTGGACAAGGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109459935 13:62643399-62643421 GTGAGCACACACCTGGACAAGGG - Intergenic
1109483557 13:62988942-62988964 CTGAACATAAAACATGAAAAAGG + Intergenic
1109636340 13:65122796-65122818 GTGAAAATACAACTGCAGAATGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115179742 14:30609833-30609855 CTTGACATATAACTGGAAAATGG - Intronic
1115211632 14:30972423-30972445 GTGAACGTACACTTGGACAAGGG - Intronic
1115329440 14:32179588-32179610 CAGGACATTGAACTGGACAAAGG - Intergenic
1115737266 14:36346641-36346663 CTTGAAATGCAACTGGACAATGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1118670288 14:68118649-68118671 CTCAAAATACACCTGCACAATGG - Intronic
1119739452 14:77004816-77004838 CTGAGCAGACACCTGGACTATGG - Intergenic
1120395732 14:83964748-83964770 GTGAGCACACACCTGGACAAGGG - Intergenic
1125761918 15:42102782-42102804 CTGAACATACGTCTGGACTGAGG - Intergenic
1126084476 15:44998962-44998984 CTGAACACACAATTTGAAAAAGG - Intergenic
1126297515 15:47157099-47157121 ATGGACATACAACTGTACACTGG + Intergenic
1127282294 15:57502754-57502776 CTGAATATACAACTTGAACAAGG - Intronic
1129196385 15:73969700-73969722 CTGAACATACACGTGCACCATGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1137529849 16:49272253-49272275 CTGAACTCCCAACTGGACACTGG + Intergenic
1138296627 16:55891256-55891278 GTGAGCACACACCTGGACAAGGG - Intronic
1138900117 16:61258660-61258682 CTGTACACACAACCGGAGAAGGG + Intergenic
1139337031 16:66239970-66239992 AAGACCATACAACTGGTCAAGGG - Intergenic
1140637934 16:76938596-76938618 AGGAACACACAAATGGACAATGG + Intergenic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1147172134 17:38627904-38627926 CAGAAAATCCAACAGGACAAAGG + Intergenic
1148965741 17:51434431-51434453 GTGAGCACACACCTGGACAAGGG + Intergenic
1152920408 17:83063831-83063853 TTGACCATAGAACAGGACAATGG - Intergenic
1153783988 18:8517962-8517984 CAGAACAAAAAAATGGACAAAGG + Intergenic
1153807885 18:8725469-8725491 CTCAATATACAACTATACAAAGG + Intronic
1153831456 18:8927287-8927309 CTGCAAATAAGACTGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155713121 18:28906944-28906966 CACAACATACAATTTGACAACGG + Intergenic
1156488789 18:37484374-37484396 CTGAAAAAACAACTGGGGAATGG + Intronic
1156946517 18:42839749-42839771 ATGAACATACGAATGGACAGTGG + Intronic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157998933 18:52593791-52593813 CTGAACATGCATCTAGACATTGG + Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1164434992 19:28221366-28221388 CTGGACATACAACTGGACAGTGG - Intergenic
1167920710 19:52781010-52781032 CTGAGGAGACAACTGGACACAGG + Intronic
1167922580 19:52794075-52794097 CTGAGGAGACAACTGGACACAGG + Intronic
1167970202 19:53184509-53184531 TTGAGGAGACAACTGGACAAAGG + Intronic
925175959 2:1784071-1784093 ATGAAAATACAAGCGGACAATGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927402812 2:22733157-22733179 CAGGACATGGAACTGGACAAAGG + Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928415352 2:31087160-31087182 CAGAAGACACAACTTGACAAAGG + Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
931107389 2:59071405-59071427 CTAGAAATACAACTGTACAAGGG + Intergenic
931267951 2:60677243-60677265 CCGAGCATACCACTGGATAAAGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933262633 2:80147423-80147445 CTGAACATAAAAATGGCGAATGG + Intronic
933522865 2:83394800-83394822 TTGAACATACAAAAGGGCAATGG + Intergenic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
934126835 2:88902133-88902155 CTGAACAGACAACTACAGAATGG - Intergenic
934186340 2:89680180-89680202 CTCAACAAAAAAATGGACAAAGG - Intergenic
934315673 2:91917050-91917072 CTCAACAAAAAAATGGACAAAGG + Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939152393 2:138488334-138488356 CTGAATAAATAACTGGAGAATGG + Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940303707 2:152202865-152202887 GTGAACACACATTTGGACAAGGG - Intergenic
941111479 2:161422867-161422889 CTGAACAATCAAATGGACACAGG + Intronic
941471709 2:165896533-165896555 CTGAACAGAAAACAGGATAAAGG + Intronic
943633850 2:190283443-190283465 GTGAGCATACACCTGGACAAGGG - Intronic
944291889 2:198017389-198017411 CTGCAGATTTAACTGGACAAAGG - Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
947556820 2:231100284-231100306 GTGAACACACACTTGGACAAGGG + Intronic
1168824520 20:800802-800824 GTGAGCACACATCTGGACAAGGG - Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169280448 20:4262680-4262702 CTTAACATACAAATCCACAATGG - Intergenic
1170463789 20:16604182-16604204 TTGAACATACAACGGAACATTGG + Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171236416 20:23529062-23529084 GTGAGCACACACCTGGACAAGGG + Intergenic
1171487955 20:25497427-25497449 CTGCAGATAGAACTGGAGAAAGG - Intronic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177771775 21:25524792-25524814 AAGAACATACCACTGGAGAAAGG + Intergenic
1178183681 21:30194213-30194235 CTGGACATATAAGTGGACAATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1182006938 22:26968730-26968752 CTGAAAAAACAACAGAACAACGG - Intergenic
950456289 3:13094689-13094711 CTGGCCATACTACTGGACAGAGG + Intergenic
950845871 3:16015606-16015628 GTGAGCACACACCTGGACAAGGG + Intergenic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952546551 3:34426158-34426180 CTGAAAATACAAGAGGACCAAGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
954480974 3:50801169-50801191 GTGAGCACACACCTGGACAAGGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956423068 3:69104686-69104708 CAGAACATAGGTCTGGACAAGGG - Exonic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956927923 3:74009400-74009422 AAGAACATACAACTGGTCCAGGG - Intergenic
957216298 3:77324440-77324462 CTTTCCCTACAACTGGACAACGG - Intronic
959563303 3:107807559-107807581 CGGAACATGCACCTTGACAATGG + Intronic
960219408 3:115087331-115087353 ATGAAGATATAACTGGAAAAAGG - Intronic
961582003 3:127890968-127890990 GTGAGCACACACCTGGACAAGGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
967065474 3:185911491-185911513 CTAAACAAACAATTGGAAAAGGG - Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
967875002 3:194262506-194262528 CTGGACATGAAACTGGACATTGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
973006782 4:45017600-45017622 GTGAACACACACTTGGACAAGGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974391446 4:61275148-61275170 CTGTTCATACAACTGGAACAAGG + Intronic
975181574 4:71351697-71351719 CTAAAAATACAAGTGGAGAAGGG + Intronic
976955284 4:90889633-90889655 ATCAACAGATAACTGGACAAAGG + Intronic
977217607 4:94300356-94300378 AAAAACATACAACTGTACAATGG - Intronic
977947920 4:102935158-102935180 CTCAACAAAAAAATGGACAAAGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
984494138 4:180473148-180473170 CTGAACATAAAAATCAACAAAGG - Intergenic
986664280 5:10086776-10086798 CAGACAATACAACTGTACAATGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
993146341 5:84098191-84098213 CTGAACATATAAATGTAAAATGG + Intronic
994247267 5:97492850-97492872 CTCAACATAAAATTGTACAAAGG + Intergenic
995347015 5:111133051-111133073 CTGAACTTAGAACTGGAGAAGGG + Intergenic
995860384 5:116634696-116634718 CTGAACGTATAAGTGGGCAAGGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1001081900 5:168673248-168673270 CTGAACCTAGTAGTGGACAAAGG - Exonic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1004093868 6:12533315-12533337 CTAAACATAAAACAGCACAACGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004428304 6:15521577-15521599 CTGTACACACAACCGGAGAAGGG - Exonic
1004770151 6:18772071-18772093 CTTAACCTAAAATTGGACAAGGG - Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1008107270 6:47452487-47452509 CTAAAGATAAAACTGGAAAAGGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1010336869 6:74695662-74695684 CTGAACAAACAACCAGACACAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011607049 6:89116288-89116310 TTGAACAGACAACTTGAAAATGG - Intronic
1013256110 6:108387402-108387424 CTGCACATACACCTGGGCTATGG + Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG + Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015041251 6:128722604-128722626 CTAAACATTCAACTGCAAAAGGG - Intergenic
1015132407 6:129828302-129828324 AAGAACATACAAATGGTCAAAGG - Intergenic
1016063854 6:139658510-139658532 CTGGCCATACAATTGGAGAAAGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1023436069 7:40141874-40141896 GTGAGCACACACCTGGACAAGGG + Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025021093 7:55480782-55480804 TTGAACACACAAATGGACATAGG - Intronic
1028073341 7:86479402-86479424 CTCAACACTCAACTGGAGAAAGG - Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1030448051 7:109672326-109672348 CTGAACATGCTTCTGGACAAAGG + Intergenic
1031100583 7:117475389-117475411 CTGAACATTCCACAGTACAAGGG + Intronic
1031846885 7:126815973-126815995 CTAAACATACAAATACACAAAGG + Intronic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1032621831 7:133542111-133542133 CTGAAAATTCAACTGGCAAAAGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1040969542 8:53119584-53119606 CTGCAAATACAACTTGACTATGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041533056 8:58893766-58893788 CTCAAGATACAACTGAACATTGG + Intronic
1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG + Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044184296 8:89234038-89234060 GTGAGCACACAATTGGACAAGGG + Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1047863220 8:128991777-128991799 GTGAAAATAAAACTGGAGAAGGG - Intergenic
1048437416 8:134431478-134431500 CTGAACAGAGATCAGGACAAAGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050278784 9:4028732-4028754 CTGCACATACAAGTGGCAAATGG + Intronic
1050314569 9:4388200-4388222 ATGAACATAGAAGTGGAAAAGGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1052957514 9:34264885-34264907 CAGCATATACAACTGGAAAAAGG + Intronic
1053306001 9:36985384-36985406 CTGAAAACAGAACTGGAAAAGGG + Intronic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1054876317 9:70100120-70100142 CTGATCATCTAACTGGACATAGG + Intronic
1055100144 9:72455851-72455873 GTCAACATACAACTCCACAAAGG - Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1058891744 9:109367025-109367047 CAGGACATACAACTGGTAAATGG + Intergenic
1058998743 9:110325989-110326011 CTTTACATACAACTTTACAAAGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1060775913 9:126374408-126374430 CTGAACAGCCCACTGGACAGTGG - Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1185877226 X:3711603-3711625 GTGGAAATACAACTCGACAATGG - Intronic
1186046458 X:5542051-5542073 CTGAACTGACAACTCAACAATGG - Intergenic
1190483504 X:50901015-50901037 ATGAACAAACAAATGCACAAAGG + Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1191889701 X:65927407-65927429 GTGAGCACACATCTGGACAAGGG + Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193145959 X:78076006-78076028 GTGAGCATACACCTGGACAAGGG + Intronic
1193789205 X:85797887-85797909 CGGAACATACCACTCAACAAAGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1197450320 X:126605361-126605383 CTGAACTTAAAAATGGGCAAAGG + Intergenic
1198965578 X:142226393-142226415 CTGAGCACACACCTGGGCAAGGG + Intergenic
1200354461 X:155533750-155533772 AGGAACATGCTACTGGACAAAGG + Intronic
1200769508 Y:7110471-7110493 GTGAGCACACACCTGGACAAGGG - Intergenic
1201183341 Y:11371871-11371893 CTCAACAAAAAAATGGACAAAGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201541747 Y:15112315-15112337 CAGAACATGAAAGTGGACAAGGG + Intergenic
1201900323 Y:19041740-19041762 GTGAGCACACACCTGGACAAGGG + Intergenic