ID: 1169229064

View in Genome Browser
Species Human (GRCh38)
Location 20:3874930-3874952
Sequence AGGGTGAGCCCAATGGCTAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169229054_1169229064 7 Left 1169229054 20:3874900-3874922 CCCCCCTAGGGTCAGTGGCGCCT 0: 1
1: 0
2: 1
3: 12
4: 83
Right 1169229064 20:3874930-3874952 AGGGTGAGCCCAATGGCTAGAGG 0: 1
1: 0
2: 0
3: 6
4: 103
1169229049_1169229064 20 Left 1169229049 20:3874887-3874909 CCAGCTGCCTACACCCCCCTAGG 0: 1
1: 0
2: 1
3: 5
4: 199
Right 1169229064 20:3874930-3874952 AGGGTGAGCCCAATGGCTAGAGG 0: 1
1: 0
2: 0
3: 6
4: 103
1169229048_1169229064 23 Left 1169229048 20:3874884-3874906 CCTCCAGCTGCCTACACCCCCCT 0: 1
1: 0
2: 0
3: 37
4: 411
Right 1169229064 20:3874930-3874952 AGGGTGAGCCCAATGGCTAGAGG 0: 1
1: 0
2: 0
3: 6
4: 103
1169229057_1169229064 4 Left 1169229057 20:3874903-3874925 CCCTAGGGTCAGTGGCGCCTGCC 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1169229064 20:3874930-3874952 AGGGTGAGCCCAATGGCTAGAGG 0: 1
1: 0
2: 0
3: 6
4: 103
1169229058_1169229064 3 Left 1169229058 20:3874904-3874926 CCTAGGGTCAGTGGCGCCTGCCT 0: 1
1: 0
2: 3
3: 23
4: 525
Right 1169229064 20:3874930-3874952 AGGGTGAGCCCAATGGCTAGAGG 0: 1
1: 0
2: 0
3: 6
4: 103
1169229055_1169229064 6 Left 1169229055 20:3874901-3874923 CCCCCTAGGGTCAGTGGCGCCTG 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1169229064 20:3874930-3874952 AGGGTGAGCCCAATGGCTAGAGG 0: 1
1: 0
2: 0
3: 6
4: 103
1169229052_1169229064 13 Left 1169229052 20:3874894-3874916 CCTACACCCCCCTAGGGTCAGTG 0: 1
1: 0
2: 1
3: 10
4: 115
Right 1169229064 20:3874930-3874952 AGGGTGAGCCCAATGGCTAGAGG 0: 1
1: 0
2: 0
3: 6
4: 103
1169229056_1169229064 5 Left 1169229056 20:3874902-3874924 CCCCTAGGGTCAGTGGCGCCTGC 0: 1
1: 0
2: 0
3: 4
4: 129
Right 1169229064 20:3874930-3874952 AGGGTGAGCCCAATGGCTAGAGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169229064 Original CRISPR AGGGTGAGCCCAATGGCTAG AGG Exonic
900717467 1:4154096-4154118 AGCGTGAGGCCAAGGGCTGGAGG + Intergenic
902800425 1:18826221-18826243 GGGGAGAGCCAAATGGCTATCGG + Intergenic
903707205 1:25295053-25295075 AGAGTGAGCCCAAAGCCCAGGGG + Intronic
905053744 1:35075593-35075615 AGGATGTGCCCAAAGGCAAGGGG - Intronic
905151100 1:35928569-35928591 AGGCTGGGCCCAGTGGCTTGTGG - Exonic
906594434 1:47062547-47062569 AGGGTGAGCCCTCTGACTACCGG + Intergenic
909934941 1:81540541-81540563 AGGGTGATCACAAAGGCCAGAGG + Intronic
911655021 1:100434333-100434355 AGGAAGAGCCCAGTGGCTACTGG + Intronic
912421662 1:109546452-109546474 AGTGTGAGCCCAATGGAAGGAGG + Exonic
912763253 1:112386849-112386871 AGGGAGGGCCCAAAGGCTGGAGG + Intergenic
919972474 1:202590190-202590212 AGTCTGAGCCCAATGACGAGAGG - Exonic
922853919 1:228757887-228757909 CTGCTGAGCCCAATGGCAAGTGG + Intergenic
924941103 1:248812868-248812890 AGGGTGAGGCCTCCGGCTAGCGG - Intronic
1066978159 10:42388137-42388159 AGGATGTGCCCAAAGGCAAGGGG + Intergenic
1074554025 10:114471921-114471943 AGAGTGAGCCGATTGGCCAGGGG + Intronic
1075094066 10:119459823-119459845 AGGGTTAGCCCAAAGGCCACAGG - Intergenic
1075214788 10:120522967-120522989 AGGGTGAGCCCTAAGCCCAGTGG + Intronic
1076260916 10:129065373-129065395 AGGGTGAACTCAATGGACAGAGG - Intergenic
1077517696 11:3011823-3011845 AGTGTGAGCCAAATGGCAGGTGG + Intronic
1079997112 11:27305912-27305934 AGGGTGAGCCAAATGCAGAGTGG - Intergenic
1080644246 11:34176556-34176578 AGGTTGAGCCCAAGAGCTGGAGG + Intronic
1084209800 11:67615662-67615684 AGCCTGAGGCCAATGGCTTGAGG + Intergenic
1084782196 11:71417615-71417637 AGGGTCATCCTAATGGCCAGAGG + Intergenic
1090592510 11:128287606-128287628 AGGGTGAGCACAATATCAAGGGG - Intergenic
1091911226 12:4232112-4232134 AGGGTGAGGGCAAGGGCGAGTGG + Intergenic
1091940664 12:4477594-4477616 TGGGTCAGCCCGAGGGCTAGTGG + Intergenic
1094545387 12:31399697-31399719 ACTGTTAGCCAAATGGCTAGTGG - Exonic
1095820413 12:46472383-46472405 AGGGTGAGCTCAATGCTTGGTGG - Intergenic
1101032833 12:100676975-100676997 AGGGTGGGCCCAATGCCAAGAGG + Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1110504717 13:76272127-76272149 CGGGTGAGGCCTATGGCTACTGG + Intergenic
1116910380 14:50457186-50457208 AGGGTGAGCCCAATCGACAAAGG + Intronic
1118908676 14:70043232-70043254 AGGATGGGCCCAATGGGCAGAGG + Intergenic
1121051398 14:90821062-90821084 AGGGTGAGGCCAAAGGTTAGAGG - Intergenic
1121996111 14:98604554-98604576 AGGGTGAGCCAAGTGGGAAGGGG + Intergenic
1127525935 15:59792115-59792137 AGGGAGGGCCTAATGGCTGGGGG - Intergenic
1128075423 15:64822648-64822670 AGGGTGGGGGCAATGCCTAGCGG - Intronic
1129794066 15:78362759-78362781 GGGGTGACTCTAATGGCTAGAGG - Intergenic
1130410093 15:83639916-83639938 AGGGTGAGACCCTGGGCTAGGGG + Intergenic
1130835686 15:87647335-87647357 AGGATGAGCCCACAGGCCAGCGG - Intergenic
1131069211 15:89454560-89454582 AGGTTGAAGCCAATGGCAAGAGG + Intergenic
1131953492 15:97706394-97706416 AGGGTGAGTCCAAAGGCCTGAGG + Intergenic
1135875993 16:26200492-26200514 ATGGTGAGCAGAATGGCAAGAGG - Intergenic
1136495372 16:30640014-30640036 CGCTTGAGCCCAGTGGCTAGAGG + Intergenic
1136522317 16:30805188-30805210 AGCGTGAGCCCAGAGGCTTGAGG - Intergenic
1139960092 16:70712471-70712493 AGCCTGAGCCCAATGGCTCAGGG - Intronic
1146620735 17:34395167-34395189 AGGGTGAGGAGAATGGCAAGGGG + Intergenic
1148521293 17:48278215-48278237 AGGATGAGCTCAATGCCTAATGG - Intronic
1150009519 17:61491115-61491137 ACGGGGAGGCCAATGGCCAGAGG + Intergenic
1153140444 18:1966537-1966559 AGGGGAAGCCCACTGGCTAAAGG + Intergenic
1153982508 18:10322128-10322150 AAGGTGAGGCCAATGGCGATGGG - Intergenic
1161030830 19:2057002-2057024 AGGGGGAGCCCACTGGAGAGTGG - Intergenic
1161258259 19:3321645-3321667 AGGGAGAAGCCACTGGCTAGGGG + Intergenic
1164804087 19:31102777-31102799 AGGGTGGGGCCAATGTCTAAGGG - Intergenic
1168403030 19:56097023-56097045 AGGGTGAGACCCATGGCTCTAGG - Intronic
927276520 2:21266917-21266939 AGGCTGAGCCCCATGCTTAGTGG + Intergenic
927570405 2:24154005-24154027 AGGGTGAGCCCAGTGAGTAGGGG - Intronic
928980562 2:37131816-37131838 AGGATGTGCCCAAAGGCAAGGGG - Intronic
929744775 2:44645394-44645416 AGGGTGAGCCCAAGGAGAAGGGG + Intronic
929854971 2:45629222-45629244 AGGATCAACCCAATGGCCAGTGG - Intergenic
932453079 2:71828177-71828199 GGGGTGAGCCCAAGGGCCAGGGG - Intergenic
937640017 2:124201568-124201590 ATGGTGAGCCCCATGGGGAGAGG - Intronic
940840433 2:158573888-158573910 AGGGTGTGCCCATGGGCAAGGGG + Intronic
941007597 2:160263450-160263472 AGGAAGAGCCCATTGGTTAGAGG - Intronic
941511067 2:166410652-166410674 AGGTTGAGCTCAATAGCTAAAGG + Intronic
944580070 2:201124704-201124726 AGGGGGAACAGAATGGCTAGGGG + Intronic
948474609 2:238209088-238209110 AGGATGTGCCCAAAGGCAAGGGG + Intergenic
1168811080 20:705050-705072 GGGGGGGGCACAATGGCTAGAGG - Intergenic
1169229064 20:3874930-3874952 AGGGTGAGCCCAATGGCTAGAGG + Exonic
1175633485 20:60561196-60561218 AGGGTGAGGCCATTGTCTTGGGG - Intergenic
1175824910 20:61931517-61931539 AGGGTGAGCCCGGAGGCGAGAGG - Intronic
1178423330 21:32459334-32459356 GAGGTGATCCCAATGCCTAGGGG - Intronic
1178720767 21:35007289-35007311 AGGTTGAGCCCCATGGGCAGTGG + Intronic
1180997936 22:19974719-19974741 AGGGTGGGCCCTGTTGCTAGGGG - Intronic
1181922817 22:26333760-26333782 AGGGTGAGCACAAGGGCTGCAGG + Intronic
1184673885 22:46029810-46029832 AGGATGAGCTCATTGGCAAGTGG - Intergenic
950124215 3:10501672-10501694 AGGGTGAAGCCAGGGGCTAGGGG + Intronic
958602333 3:96312437-96312459 AGGTTGGGCCCAATGGAAAGGGG - Intergenic
960614753 3:119586321-119586343 CGGGCAAGCCCAATGGCTGGAGG + Exonic
961209004 3:125110728-125110750 AGGGTGAGCTTAAAGGCAAGAGG - Intronic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
969173682 4:5383682-5383704 AGGGTGAGTCCACTGCCTAGTGG - Intronic
976097566 4:81525890-81525912 AGGTTCAGCCCAATGGATAGGGG + Intronic
985744342 5:1637815-1637837 TGGGTGAGCCTAGTGGCCAGGGG + Intergenic
986268460 5:6210874-6210896 AGGCTGAGTGCAAAGGCTAGGGG + Intergenic
992464271 5:76988291-76988313 AGGGTGAGACCAATCCCTAATGG - Intergenic
992974211 5:82096493-82096515 AAGGTGAAGCCAAGGGCTAGAGG - Intronic
994816694 5:104594825-104594847 AGGATGTGCCCAAAGGCAAGAGG - Intergenic
1000146137 5:158454949-158454971 AGGGTGAGGCCAACTGCTGGAGG + Intergenic
1000266399 5:159641874-159641896 AGGGTGAGTGGAATGGCGAGGGG - Intergenic
1016629040 6:146206218-146206240 GAGGTAAGCCCAATGGCTTGTGG + Intronic
1017110878 6:150931658-150931680 ATGGTGAGGCCCATGGCTAATGG + Intronic
1019587680 7:1814008-1814030 AGGGTGGGCCCAGAGGCTGGAGG - Intergenic
1026137087 7:67673035-67673057 AGGGTCAGACCATTGTCTAGTGG + Intergenic
1030013015 7:105189891-105189913 TGGGTGAGGCCACTGGCTATAGG + Intronic
1032258588 7:130316410-130316432 AGGATGTGCCCAAAGGCAAGGGG + Intronic
1042162520 8:65911820-65911842 AGGGAGTGCACAATGACTAGAGG + Intergenic
1043546746 8:81324058-81324080 AGGGTGACTAGAATGGCTAGGGG - Intergenic
1044375710 8:91468110-91468132 AGGGTGAGACCAATGCCTGTGGG + Intergenic
1048229513 8:132623821-132623843 AGGGTGAAGCCAAGGGCTTGTGG - Intronic
1049694181 8:143975639-143975661 AGGGTAAGGCCAGTGGCTGGGGG - Intronic
1059565492 9:115379884-115379906 AGGGAGGGCCCAAAGGCTGGGGG + Intronic
1062252044 9:135603188-135603210 AGGGGGAGCACAGTGGTTAGGGG - Intergenic
1062448263 9:136604771-136604793 AGGCTGAGCCCCATGCCTTGGGG + Intergenic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1187860577 X:23678652-23678674 AGGCTGAGCACAATGGCTCACGG + Intronic
1195540718 X:106059531-106059553 AGAGAGAGCCCAAAGGCTCGTGG - Intergenic
1196688839 X:118536961-118536983 AAGGAGAGCCGAATGACTAGGGG + Intronic
1199661149 X:150052385-150052407 AGGGTGTGGCCACTGGTTAGAGG - Intergenic
1200120811 X:153789692-153789714 AGGGTGAGCTCCAGGGCCAGGGG - Exonic