ID: 1169229065

View in Genome Browser
Species Human (GRCh38)
Location 20:3874931-3874953
Sequence GGGTGAGCCCAATGGCTAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 80}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169229057_1169229065 5 Left 1169229057 20:3874903-3874925 CCCTAGGGTCAGTGGCGCCTGCC 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1169229065 20:3874931-3874953 GGGTGAGCCCAATGGCTAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 80
1169229054_1169229065 8 Left 1169229054 20:3874900-3874922 CCCCCCTAGGGTCAGTGGCGCCT 0: 1
1: 0
2: 1
3: 12
4: 83
Right 1169229065 20:3874931-3874953 GGGTGAGCCCAATGGCTAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 80
1169229056_1169229065 6 Left 1169229056 20:3874902-3874924 CCCCTAGGGTCAGTGGCGCCTGC 0: 1
1: 0
2: 0
3: 4
4: 129
Right 1169229065 20:3874931-3874953 GGGTGAGCCCAATGGCTAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 80
1169229052_1169229065 14 Left 1169229052 20:3874894-3874916 CCTACACCCCCCTAGGGTCAGTG 0: 1
1: 0
2: 1
3: 10
4: 115
Right 1169229065 20:3874931-3874953 GGGTGAGCCCAATGGCTAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 80
1169229058_1169229065 4 Left 1169229058 20:3874904-3874926 CCTAGGGTCAGTGGCGCCTGCCT 0: 1
1: 0
2: 3
3: 23
4: 525
Right 1169229065 20:3874931-3874953 GGGTGAGCCCAATGGCTAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 80
1169229055_1169229065 7 Left 1169229055 20:3874901-3874923 CCCCCTAGGGTCAGTGGCGCCTG 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1169229065 20:3874931-3874953 GGGTGAGCCCAATGGCTAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 80
1169229048_1169229065 24 Left 1169229048 20:3874884-3874906 CCTCCAGCTGCCTACACCCCCCT 0: 1
1: 0
2: 0
3: 37
4: 411
Right 1169229065 20:3874931-3874953 GGGTGAGCCCAATGGCTAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 80
1169229049_1169229065 21 Left 1169229049 20:3874887-3874909 CCAGCTGCCTACACCCCCCTAGG 0: 1
1: 0
2: 1
3: 5
4: 199
Right 1169229065 20:3874931-3874953 GGGTGAGCCCAATGGCTAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169229065 Original CRISPR GGGTGAGCCCAATGGCTAGA GGG Exonic
903066946 1:20704934-20704956 GGGTGAGCCCTATGTATCGAGGG + Intronic
907275779 1:53315927-53315949 GGGAGAGACCAAGGGCCAGAGGG + Intronic
919972473 1:202590189-202590211 GTCTGAGCCCAATGACGAGAGGG - Exonic
922022319 1:221717289-221717311 GGGTGAGGAGAAGGGCTAGAGGG + Intronic
922853920 1:228757888-228757910 TGCTGAGCCCAATGGCAAGTGGG + Intergenic
1070986398 10:80693419-80693441 GGGTGAGGCCAGTGGGTATAAGG + Intergenic
1072277548 10:93838037-93838059 GGGTGATCCAAGTGGCTAGCTGG - Intergenic
1074904925 10:117853123-117853145 GGTTGAGCCCCATGGAGAGATGG + Intergenic
1080222641 11:29923907-29923929 GCGTGAGCCCAATGTCAAAATGG + Intergenic
1080613767 11:33928040-33928062 GGGTGAGCTAAATGGATTGAAGG - Intergenic
1084763821 11:71294559-71294581 GGGGGAGCCCACTGCCTTGAAGG - Intergenic
1087665979 11:101048111-101048133 GGGTGAAGCCACTGGCTAGAAGG + Intronic
1091294068 11:134460254-134460276 GGGTGAGCCCAGTGGAGTGATGG + Intergenic
1091940665 12:4477595-4477617 GGGTCAGCCCGAGGGCTAGTGGG + Intergenic
1102146476 12:110658566-110658588 GAGTGAGCCCGATGGGTGGATGG - Intronic
1106031498 13:26009519-26009541 GGGTGTGCACATTGGCTATATGG + Intronic
1106555825 13:30807650-30807672 GAGTGAGCCCAAGGAATAGAGGG + Intergenic
1108589739 13:51902557-51902579 GGGAGAGTCCCATGGTTAGAGGG + Intergenic
1112465120 13:99637219-99637241 GGGTGAGCACAATGGCAAACTGG - Intronic
1114495897 14:23131846-23131868 GGGTGTTCCCAATGCCTGGAAGG + Intronic
1114613882 14:24058301-24058323 GGGTCAGCACAGAGGCTAGATGG - Intronic
1115918426 14:38343256-38343278 GGGTGAACTCAACGCCTAGAAGG + Intergenic
1118908677 14:70043233-70043255 GGATGGGCCCAATGGGCAGAGGG + Intergenic
1119160514 14:72448404-72448426 GGGTGAGCACAATGAGTAGGTGG - Intronic
1124044578 15:26137178-26137200 GGGTGAGACCTATGGGTATACGG + Intergenic
1128631917 15:69276744-69276766 GGTTGAGCCCACTGTGTAGACGG - Intergenic
1131953493 15:97706395-97706417 GGGTGAGTCCAAAGGCCTGAGGG + Intergenic
1132703068 16:1230179-1230201 GGGAGAGCCCACTGGGTAGAAGG - Exonic
1132705254 16:1240689-1240711 GGGAGAGCCCACTGGGTAGAAGG + Exonic
1132708383 16:1256052-1256074 GGGAGAGCCCGCTGGGTAGAAGG + Intronic
1138455695 16:57119480-57119502 GGGTCAGCCCAATGGGGACAGGG - Intronic
1142077403 16:88128134-88128156 GGGTGACCCAGATGGCGAGACGG + Intergenic
1148760029 17:49994821-49994843 GGGCCAGCCCTATGGCCAGACGG - Exonic
1150009520 17:61491116-61491138 CGGGGAGGCCAATGGCCAGAGGG + Intergenic
1150189755 17:63225622-63225644 GGCTGGGGCAAATGGCTAGATGG - Intronic
1155589409 18:27409320-27409342 ATGTGAGCCCCATGGGTAGAGGG - Intergenic
1160517687 18:79487512-79487534 GTGCGAGCCCAGGGGCTAGATGG - Intronic
1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG + Intergenic
1166853500 19:45771253-45771275 GGGTGAGCCCTATATCTGGACGG + Intronic
925057716 2:868156-868178 GGGTGCGCCCTTTGTCTAGACGG + Intergenic
925206707 2:2013393-2013415 GGCAGAGCCCAGTGGCTGGATGG - Intronic
926557465 2:14376167-14376189 GGGTGAGAACAAAGGGTAGATGG - Intergenic
928465877 2:31521933-31521955 GGCTGAGGCCAATGGGAAGATGG - Intergenic
929429417 2:41874521-41874543 ATGTGATCCCAGTGGCTAGATGG - Intergenic
932823573 2:74921219-74921241 GGGTGTGCCCAAGCCCTAGAGGG - Intergenic
934074502 2:88416350-88416372 GGGTGAGCCCAACAGTGAGAGGG + Intergenic
934609848 2:95727021-95727043 GGGTGAGCCCAGAGGCTGGGAGG + Intergenic
936543174 2:113368594-113368616 GGGTGAACCCAGAGGCTGGAAGG + Intergenic
938930694 2:136084183-136084205 GGGTGAACCCAACAGCCAGAAGG + Intergenic
944879311 2:203995176-203995198 TGGTGAGCCCAATCGCAATATGG + Intergenic
945338300 2:208618553-208618575 GGGTGAGGCCTATTGCTAGCAGG - Intronic
1169229065 20:3874931-3874953 GGGTGAGCCCAATGGCTAGAGGG + Exonic
1169896877 20:10513692-10513714 GGCTGGGCCCAAGGGCTAGAAGG + Intronic
1172226353 20:33307543-33307565 GGGTGAGCCCTGTGGGTAGCTGG + Intronic
1174351860 20:49974308-49974330 GGGTGAGCCCTGTGGCTATATGG + Intergenic
1175824909 20:61931516-61931538 GGGTGAGCCCGGAGGCGAGAGGG - Intronic
1183712144 22:39511306-39511328 TGGTGAGCGCAAAGGCAAGAAGG + Exonic
952834858 3:37594038-37594060 GGGTGAGCCCAGTGGCAAAGTGG - Intronic
953828665 3:46276766-46276788 GGGTGTGCCCGAGGGCTAGGAGG + Intergenic
954697437 3:52435282-52435304 GGGTGTGCCCAGAGGCAAGAGGG - Exonic
954879623 3:53824421-53824443 GGCTGAGCCCACTGTCTTGAAGG - Intronic
956151812 3:66251517-66251539 GGCTGGGCCCACTGGCAAGATGG - Intronic
958895059 3:99820178-99820200 GGGTTAGTCTTATGGCTAGAAGG - Intronic
961034090 3:123630128-123630150 GTGTGTGCCCAATGGATAGATGG + Intronic
969094105 4:4719168-4719190 AGGTGAGCCCCATGGCTATCAGG - Intergenic
979524941 4:121706773-121706795 GGGTGAGGACAATGACAAGATGG - Intergenic
981103959 4:140859278-140859300 AGGTGAGGCCAATGAATAGAGGG + Intergenic
982316379 4:154036113-154036135 GGGGGAGCCCAAAGGAGAGAAGG + Intergenic
984144941 4:176048801-176048823 GTGGGAGCCAAATGGCTAAAAGG - Intergenic
985112434 4:186559881-186559903 GGGTAAGACCAATGGCAAAAGGG - Intergenic
992888773 5:81185099-81185121 GGGTGATCACAATTGCTAGCAGG - Intronic
992974210 5:82096492-82096514 AGGTGAAGCCAAGGGCTAGAGGG - Intronic
994816693 5:104594824-104594846 GGATGTGCCCAAAGGCAAGAGGG - Intergenic
997653589 5:135539341-135539363 GGGTGAACCCAGTGGAAAGAGGG + Intergenic
998463727 5:142326635-142326657 GGGTGAGCCGAATGGTGAGAAGG - Intergenic
1016629041 6:146206219-146206241 AGGTAAGCCCAATGGCTTGTGGG + Intronic
1019060129 6:169251591-169251613 GGGTGTGACCAATTGCTGGAAGG - Intronic
1024185936 7:46947739-46947761 AGGTTAGCACAATGGGTAGAGGG + Intergenic
1030013016 7:105189892-105189914 GGGTGAGGCCACTGGCTATAGGG + Intronic
1039772795 8:40704910-40704932 GGATGTGTCCTATGGCTAGAAGG + Intronic
1042757214 8:72228223-72228245 CAGTGACCACAATGGCTAGATGG - Intergenic
1048203380 8:132395745-132395767 GGATGAGCCCAATGCCTGTAAGG - Intronic
1203568626 Un_KI270744v1:111650-111672 GGGAGAGCCCAATGGCTTCATGG + Intergenic
1186602123 X:11049439-11049461 AGGTGAGCCCACTGCCTTGAAGG - Intergenic
1187905039 X:24057838-24057860 CGGTGAACCTAATGGCTAAATGG + Intronic
1193630738 X:83884499-83884521 GCCTAAGCCCAATGTCTAGAAGG + Intronic
1195933709 X:110105411-110105433 GGGTGTGGCAAATGGCTATAGGG - Intronic
1196508395 X:116476476-116476498 AGGAGAGCCCAATGCCTGGAAGG - Intergenic
1200230642 X:154442267-154442289 GGCTGAGCCCAAGGGGGAGAGGG + Intronic
1201497486 Y:14604201-14604223 GTGAGGGCCCAATGCCTAGAGGG - Intronic