ID: 1169230882

View in Genome Browser
Species Human (GRCh38)
Location 20:3888473-3888495
Sequence TACCAAAGGCTGCCCAAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169230882_1169230891 2 Left 1169230882 20:3888473-3888495 CCGGGCTTGGGCAGCCTTTGGTA No data
Right 1169230891 20:3888498-3888520 GGGGATGCTTGGAAGGGTCAGGG No data
1169230882_1169230893 17 Left 1169230882 20:3888473-3888495 CCGGGCTTGGGCAGCCTTTGGTA No data
Right 1169230893 20:3888513-3888535 GGTCAGGGTCTCAGTCCTGGAGG No data
1169230882_1169230887 -9 Left 1169230882 20:3888473-3888495 CCGGGCTTGGGCAGCCTTTGGTA No data
Right 1169230887 20:3888487-3888509 CCTTTGGTAGTGGGGATGCTTGG No data
1169230882_1169230888 -5 Left 1169230882 20:3888473-3888495 CCGGGCTTGGGCAGCCTTTGGTA No data
Right 1169230888 20:3888491-3888513 TGGTAGTGGGGATGCTTGGAAGG No data
1169230882_1169230892 14 Left 1169230882 20:3888473-3888495 CCGGGCTTGGGCAGCCTTTGGTA No data
Right 1169230892 20:3888510-3888532 AAGGGTCAGGGTCTCAGTCCTGG No data
1169230882_1169230889 -4 Left 1169230882 20:3888473-3888495 CCGGGCTTGGGCAGCCTTTGGTA No data
Right 1169230889 20:3888492-3888514 GGTAGTGGGGATGCTTGGAAGGG No data
1169230882_1169230890 1 Left 1169230882 20:3888473-3888495 CCGGGCTTGGGCAGCCTTTGGTA No data
Right 1169230890 20:3888497-3888519 TGGGGATGCTTGGAAGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169230882 Original CRISPR TACCAAAGGCTGCCCAAGCC CGG (reversed) Intergenic
No off target data available for this crispr